Skip to content

Add flags to deepvariant related to recalibration - #1959

Closed
famosab wants to merge 4 commits into
devfrom
dv
Closed

Add flags to deepvariant related to recalibration#1959
famosab wants to merge 4 commits into
devfrom
dv

Conversation

@famosab

@famosab famosab commented Aug 21, 2025

Copy link
Copy Markdown
Member

PR checklist

  • This comment contains a description of changes (with reason).
  • If you've fixed a bug or added code that should be tested, add tests!
  • If you've added a new tool - have you followed the pipeline conventions in the contribution docs
  • If necessary, also make a PR on the nf-core/sarek branch on the nf-core/test-datasets repository.
  • Make sure your code lints (nf-core pipelines lint).
  • Ensure the test suite passes (nextflow run . -profile test,docker --outdir <OUTDIR>).
  • Check for unexpected warnings in debug mode (nextflow run . -profile debug,test,docker --outdir <OUTDIR>).
  • Usage Documentation in docs/usage.md is updated.
  • Output Documentation in docs/output.md is updated.
  • CHANGELOG.md is updated.
  • README.md is updated (including new tool citations and authors/contributors).

Closes #682

@famosab famosab linked an issue Aug 21, 2025 that may be closed by this pull request
Deepvariant requires additional cli option for recalibrated BAM files #682
Open
@FriederikeHanssen

FriederikeHanssen commented Aug 21, 2025

Copy link
Copy Markdown
Contributor

how did you get the data to work. I got blocked on the tests here: #1733

@famosab

famosab commented Aug 21, 2025 •
edited
Loading

Copy link
Copy Markdown
Member Author

I tried it out now, i just realized you had the PR going already 🙈 but mine was more of a quick fix to basically implement the first of the two proposed ways to do this.

I also ran into issues with:
FATAL Flags parsing error: Unknown command line flag 'parse_sam_aux_fields'

@famosab

famosab commented Aug 21, 2025

Copy link
Copy Markdown
Member Author

I tried to use data with complete re-alignment in a test but that still threw the same error so I am not even sure why its not working (as you said in #1733 its because we have no scores but if I re-align it completely in the test it should work but it does not. I will be closing this trial in favor of #1733 (and adding comments over there :) ) as I did not realize beforehand that you had this open already!

@github-actions

github-actions Bot commented Aug 21, 2025 •
edited
Loading

Copy link
Copy Markdown

nf-core pipelines lint overall result: Passed ✅ ⚠️

Posted for pipeline commit 9387be1

+| ✅ 225 tests passed       |+
#| ❔  12 tests were ignored |#
!| ❗   7 tests had warnings |!
Details

❗ Test warnings:

  • pipeline_todos - TODO string in base.config: Check the defaults for all processes
  • pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
  • pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
  • pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
  • schema_lint - Input mimetype is missing or empty
  • schema_description - No description provided in schema for parameter: markduplicates_pixel_distance
  • schema_description - No description provided in schema for parameter: gatk_pcr_indel_model

❔ Tests ignored:

✅ Tests passed:

Run details

  • nf-core/tools version 3.3.2
  • Run at 2025-08-21 12:50:05

maxulysse
maxulysse reviewed Aug 21, 2025
View reviewed changes
Comment thread tests/csv/3.0/fastq_germline.csv Outdated
@famosab

famosab commented Aug 21, 2025

Copy link
Copy Markdown
Member Author

As part of the error I get:

  2025-08-21 14:09:42.759286: W third_party/nucleus/io/sam_reader.cc:612] Could not read base quality scores testN:1498: NOT_FOUND: Could not read base quality scores

If I run samtools view and grep (as proposed here google/deepvariant#434)

 $ samtools view -t genome.fasta test.recal.cram | grep testN:1498
testN:1498      163     chr22   3466    60      92S33M18S       =       3507    91      ATATAGGCCATGAAGAAACTGACCCTAATATGAAATTATCGAATCAACTATCTCCTAAAATATGAACAAAATTTCCAAAACATGCAAGAGACATTTTTACTGAAGAAAGCATTGACTAATCAAAGCAATTGCAACTATATATT >4>43=555>>44?4>4?>>4>>55>3443>4444>>344>44>>>44534454>>>4>>43>4>?4>?444>545?4?>>4>4?4444?44?>5>>>>4>4??4>?>45>>?4?453?4>4444>4445454>4>34343>>   AS:i:33 MC:Z:41S50M16S  XS:i:0  MD:Z:33 NM:i:0  RG:Z:1
testN:1498      83      chr22   3507    42      41S50M16S       =       3466    -91     ATTTTTAATGAAGAAATGATTGAATAATGAATTGATTTGGTACTTTTTATTTTGGCATTTAAATTTAGTGTAATTATTTTATCATTAAATTATTATGTTAAATATTA     4?44?3>4>>554>>>44>4>4>435444>>44>44?4>4354>>>?>4?>?>>5=>?4>5>44?3>444>5>?>>>44344>>>>>>>?>>>>>4>>>>5>>>>>>       AS:i:20 MC:Z:92S33M18S  XS:i:0  MD:Z:7C14G1A3C10C0C9    NM:i:6  RG:Z:1

at least AS: Paired-end alignment quality is present, right?

@famosab

famosab commented Aug 21, 2025

Copy link
Copy Markdown
Member Author

Error persists even after using
samtools view -bh -F 256 -t genome.fasta test.recal.cram > test.recal.bam the test.recal.bam file then.

@famosab famosab closed this Aug 21, 2025
@famosab
famosab deleted the dv branch August 21, 2025 12:47
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment

Reviewers

@maxulysse maxulysse maxulysse left review comments
@FriederikeHanssen FriederikeHanssen Awaiting requested review from FriederikeHanssen FriederikeHanssen is a code owner

Assignees

No one assigned

Labels

None yet

Projects

None yet

Milestone

No milestone

Development

Successfully merging this pull request may close these issues.

Deepvariant requires additional cli option for recalibrated BAM files

3 participants

@famosab @FriederikeHanssen @maxulysse