AllenCell · meganrm · Jul 31, 2026 · Jul 31, 2026
diff --git a/src/pages/cell-line/AICS-89-61/index.md b/src/pages/cell-line/AICS-89-61/index.md
@@ -2,6 +2,7 @@
 templateKey: cell-line
 cell_line_id: 89
 status: data complete
+date: 2026-07-30T22:44:00.000Z
 clone_number: 61
 parental_line: 0
 genetic_modifications:
@@ -20,92 +21,132 @@ genetic_modifications:
 order_link: https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=AICS-0089-061&PgId=166
 certificate_of_analysis: https://www.coriell.org/0/PDF/Allen/ipsc/AICS-0089-061_CofA.pdf
 donor_plasmid: https://www.addgene.org/The_Allen_Institute_for_Cell_Science/
-hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-39
 images_and_videos:
   images:
     - image: single_plane_image_cl61.jpg
-      caption: "Single, mid-level plane of cells in a live hiPS cell colony expressing mEGFP-tagged fibrillarin, mTagRFP-T-taggednucleophosmin, and TagBFP-tagged dCas9-KRAB. Panels show individual channels for fibrillarin, nucleophosmin, the overlayof the two, and dCas9-KRAB (clockwise from the top left). Cells were imaged in 3D on a spinning-disk confocal microscope.Scale bar, 5μm."
+      caption: Single, mid-level plane of cells in a live hiPS cell colony expressing
+        mEGFP-tagged fibrillarin, mTagRFP-T-taggednucleophosmin, and
+        TagBFP-tagged dCas9-KRAB. Panels show individual channels for
+        fibrillarin, nucleophosmin, the overlayof the two, and dCas9-KRAB
+        (clockwise from the top left). Cells were imaged in 3D on a
+        spinning-disk confocal microscope.Scale bar, 5μm.
     - image: Main_cell_line_morphology.jpg
-      caption: "Viability and colony formation one day and three days post-thaw. Cells were treated with ROCK inhibitor for 24 hrs post-thaw."
+      caption: Viability and colony formation one day and three days post-thaw. Cells
+        were treated with ROCK inhibitor for 24 hrs post-thaw.
+    - image: ReleaseWestern_AICS0089_cl061_20190822
+        Nucleolus_Triple_dcas9-KRAB_final.jpg
+    - image: AICS89_clone61_immuno_20200403_v5.jpg
   videos:
     - video: https://player.vimeo.com/video/442183009
-      caption: "Z-stack of live hiPS cell colony expressing mEGFP-tagged fibrillarin, mTagRFP-T-tagged nucleophosmin, and TagBFP-tagged dCas9-KRAB. Panels show individual channels for fibrillarin, nucleophosmin, and the overlay of the two (left to right). TagBFP-tagged dCas9-KRAB is not shown here because it was used to identify dCas9-KRAB expressing cells and not to highlight a structure (see single z-slice image for its expression pattern). Cells were imaged in 3D on a spinning-disk confocal microscope. Movie starts at the bottom of the cells and ends at the top. Scale bar, 5µm."
+      caption: Z-stack of live hiPS cell colony expressing mEGFP-tagged fibrillarin,
+        mTagRFP-T-tagged nucleophosmin, and TagBFP-tagged dCas9-KRAB. Panels
+        show individual channels for fibrillarin, nucleophosmin, and the overlay
+        of the two (left to right). TagBFP-tagged dCas9-KRAB is not shown here
+        because it was used to identify dCas9-KRAB expressing cells and not to
+        highlight a structure (see single z-slice image for its expression
+        pattern). Cells were imaged in 3D on a spinning-disk confocal
+        microscope. Movie starts at the bottom of the cells and ends at the top.
+        Scale bar, 5µm.
     - video: https://player.vimeo.com/video/442182527
-      caption: "Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged fibrillarin, mTagRFP-T-tagged nucleophosmin, and TagBFP-tagged dCas9-KRAB. Panels show individual channels for fibrillarin, nucleophosmin, and the overlay of the two (left to right). TagBFP-tagged dCas9-KRAB is not shown here because it was used to identify dCas9-KRAB expressing cells and not to highlight a structure (see single z-slice image for its expression pattern). The regions bounded by a dashed line are shown at the same scale with increased brightness to highlight changes in localization during mitosis. A single, mid-level plane of the cells was imaged every 3 min on a spinning-disk confocal microscope. Movie plays at 900x real time. Scale bar, 5 µm."
+      caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged
+        fibrillarin, mTagRFP-T-tagged nucleophosmin, and TagBFP-tagged
+        dCas9-KRAB. Panels show individual channels for fibrillarin,
+        nucleophosmin, and the overlay of the two (left to right). TagBFP-tagged
+        dCas9-KRAB is not shown here because it was used to identify dCas9-KRAB
+        expressing cells and not to highlight a structure (see single z-slice
+        image for its expression pattern). The regions bounded by a dashed line
+        are shown at the same scale with increased brightness to highlight
+        changes in localization during mitosis. A single, mid-level plane of the
+        cells was imaged every 3 min on a spinning-disk confocal microscope.
+        Movie plays at 900x real time. Scale bar, 5 µm.
     - video: https://player.vimeo.com/video/442182868
-      caption: "Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged fibrillarin, mTagRFP-T-tagged nucleophosmin, and TagBFP-tagged dCas9-KRAB. Panels show individual channels for fibrillarin, nucleophosmin, and the overlay of the two (left to right). TagBFP-tagged dCas9-KRAB is not shown here because it was used to identify dCas9-KRAB expressing cells and not to highlight a structure (see single z-slice image for its expression pattern). Cells were imaged in 3D on a spinning-disk confocal microscope every 3 min. A single mid-level plane is shown. Movie plays at 1800x real time. Scale bar, 20 µm."
+      caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged
+        fibrillarin, mTagRFP-T-tagged nucleophosmin, and TagBFP-tagged
+        dCas9-KRAB. Panels show individual channels for fibrillarin,
+        nucleophosmin, and the overlay of the two (left to right). TagBFP-tagged
+        dCas9-KRAB is not shown here because it was used to identify dCas9-KRAB
+        expressing cells and not to highlight a structure (see single z-slice
+        image for its expression pattern). Cells were imaged in 3D on a
+        spinning-disk confocal microscope every 3 min. A single mid-level plane
+        is shown. Movie plays at 1800x real time. Scale bar, 20 µm.
 editing_design:
   ncbi_isoforms:
     - n
   cr_rna: AACTGAAGTTCAGCGCTGTC / TCCAGGCTATTCAAGATCTC / TGTTGGAAGGATGAGGAAAT
   linker: KPNSAVDGTAGPGSIAT / KPNSAVDGTAGPGSIAT
   cas9: Wildtype spCas9
   diagrams:
-    - title: "mEGFP Insert"
+    - title: mEGFP Insert
       images:
         - image: EditingDesign_gene_figure.png
-          caption: "Top: FBL locus with zoom in on mEGFP insertion site at FBL C-terminal exon. Middle: NPM1 locus showing 7 NPM1 isoforms with zoom in on mTagRFP-T insertion site at NPM1 C-terminal exon. Bottom: CLYBL locus showing dCas9-TagBFP-KRAB insertion site at CLYBL safe harbor site between exons 2 and 3."
-category_labels: 
- - Tools
+          caption: "Top: FBL locus with zoom in on mEGFP insertion site at FBL C-terminal
+            exon. Middle: NPM1 locus showing 7 NPM1 isoforms with zoom in on
+            mTagRFP-T insertion site at NPM1 C-terminal exon. Bottom: CLYBL
+            locus showing dCas9-TagBFP-KRAB insertion site at CLYBL safe harbor
+            site between exons 2 and 3."
 genomic_characterization:
   diagrams:
-    - title: "Schematic of Junctions"
+    - title: Schematic of Junctions
       images:
         - image: /img/shared/GenomicCharacterization_junction_schematic_generic_insert.png
-    - title: "Karyotype Analysis"
+    - title: Karyotype Analysis
       images:
         - image: AICS-89_cl61_FBL-NPM1-dCas9-KRAB_karyotype.JPG
-          caption: "After cells banks were created, one vial was thawed and 30 G-banded metaphase cells were karyotyped."
+          caption: After cells banks were created, one vial was thawed and 30 G-banded
+            metaphase cells were karyotyped.
   amplified_junctions:
-    - edited_gene: "FBL-mEGFP"
-      junction: "5'"
+    - edited_gene: FBL-mEGFP
+      junction: 5'
       expected_size: "1424"
-      confirmed_sequence: "yes"
-    - edited_gene: "FBL-mEGFP"
-      junction: "3'"
+      confirmed_sequence: yes
+    - edited_gene: FBL-mEGFP
+      junction: 3'
       expected_size: "1489"
-      confirmed_sequence: "yes"
-    - edited_gene: "FBL-mEGFP"
-      junction: "WT internal"
+      confirmed_sequence: yes
+    - edited_gene: FBL-mEGFP
+      junction: WT internal
       expected_size: "1800"
-      confirmed_sequence: "yes"
-    - edited_gene: "FBL-mEGFP"
-      junction: "Full junctional allele"
+      confirmed_sequence: yes
+    - edited_gene: FBL-mEGFP
+      junction: Full junctional allele
       expected_size: "Tagged: bp; Untagged: bp"
-      confirmed_sequence: "yes"
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "5'"
+      confirmed_sequence: yes
+    - edited_gene: NPM1-mTagRFP-T
+      junction: 5'
       expected_size: "1489"
-      confirmed_sequence: "yes"
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "3'"
+      confirmed_sequence: yes
+    - edited_gene: NPM1-mTagRFP-T
+      junction: 3'
       expected_size: "1581"
-      confirmed_sequence: "yes"
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "WT internal"
+      confirmed_sequence: yes
+    - edited_gene: NPM1-mTagRFP-T
+      junction: WT internal
       expected_size: "2217"
-      confirmed_sequence: "yes"
-    - edited_gene: "NPM1-mTagRFP-T"
-      junction: "Full junctional allele"
+      confirmed_sequence: yes
+    - edited_gene: NPM1-mTagRFP-T
+      junction: Full junctional allele
       expected_size: "Tagged: bp; Untagged: bp"
-      confirmed_sequence: "yes"
-    - edited_gene: "CLYBL-dCas9-KRAB"
-      junction: "5'"
+      confirmed_sequence: yes
+    - edited_gene: CLYBL-dCas9-KRAB
+      junction: 5'
       expected_size: "1875"
-      confirmed_sequence: "yes"
-    - edited_gene: "CLYBL-dCas9-KRAB"
-      junction: "3'"
+      confirmed_sequence: yes
+    - edited_gene: CLYBL-dCas9-KRAB
+      junction: 3'
       expected_size: "3471"
-      confirmed_sequence: "yes"
-    - edited_gene: "CLYBL-dCas9-KRAB"
-      junction: "WT internal"
+      confirmed_sequence: yes
+    - edited_gene: CLYBL-dCas9-KRAB
+      junction: WT internal
       expected_size: "2348"
-      confirmed_sequence: "yes"
-    - edited_gene: "CLYBL-dCas9-KRAB"
-      junction: "Full junctional allele"
+      confirmed_sequence: yes
+    - edited_gene: CLYBL-dCas9-KRAB
+      junction: Full junctional allele
       expected_size: "Tagged: bp; Untagged: bp"
       confirmed_sequence: ""
-  junction_table_caption: "PCR amplified 5', 3', WT, and full allele junctions. 5', 3', and WT junctions were Sanger sequenced to check for precise mEGFP insertion. Primers were designed to exclude amplification from the donor plasmid."
+  junction_table_caption: PCR amplified 5', 3', WT, and full allele junctions. 5',
+    3', and WT junctions were Sanger sequenced to check for precise mEGFP
+    insertion. Primers were designed to exclude amplification from the donor
+    plasmid.
   ddpcr:
     - tag: FBL-mEGFP
       clone: 61
@@ -119,36 +160,55 @@ genomic_characterization:
       clone: 61
       fp_ratio: 0.538
       plasmid: 0.001
-  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: KAN/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no detectable plasmid integration. RPP30 is known 2n reference gene."
+  ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate
+    heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid:
+    KAN/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no
+    detectable plasmid integration. RPP30 is known 2n reference gene."
+category_labels:
+  - Tools
+hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-39
 stem_cell_characteristics:
   pluripotency_analysis:
-    - marker: "NANOG"
+    - marker: NANOG
       positive_cells: 99.8
-    - marker: "SOX2"
+    - marker: SOX2
       positive_cells: null
-    - marker: "OCT4"
+    - marker: OCT4
       positive_cells: 99.8
-    - marker: "SSEA-1"
+    - marker: SSEA-1
       positive_cells: null
-    - marker: "SSEA-4"
+    - marker: SSEA-4
       positive_cells: 100
-    - marker: "TRA-160"
+    - marker: TRA-160
       positive_cells: null
-  pluripotency_caption: "iPSCs were stained with directly conjugated antibodies from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, then marker-specific gates were set according to corresponding fluorescence-minus-one (FMO) controls."
+  pluripotency_caption: iPSCs were stained with directly conjugated antibodies
+    from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences),
+    and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded,
+    then marker-specific gates were set according to corresponding
+    fluorescence-minus-one (FMO) controls.
   trilineage_differentiation:
-    - germ_layer: "Ectoderm"
-      marker: "PAX6"
+    - germ_layer: Ectoderm
+      marker: PAX6
       percent_positive_cells: Pass
-    - germ_layer: "Endoderm"
-      marker: "SOX17"
+    - germ_layer: Endoderm
+      marker: SOX17
       percent_positive_cells: Pass
-    - germ_layer: "Mesoderm"
-      marker: "Brachyury"
+    - germ_layer: Mesoderm
+      marker: Brachyury
       percent_positive_cells: Pass
-  trilineage_caption: "iPSCs were subjected to a 5-7 day, non-terminal, directed differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL Technologies, Inc.). Total RNA was isolated from each lineage specific differentiation and assayed via ddPCR for the expression of lineage specific transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm)."
+  trilineage_caption: iPSCs were subjected to a 5-7 day, non-terminal, directed
+    differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL
+    Technologies, Inc.). Total RNA was isolated from each lineage specific
+    differentiation and assayed via ddPCR for the expression of lineage specific
+    transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm).
   cardiomyocyte_differentiation:
-    troponin_percent_positive: "78.6 (1)"
-    day_of_beating_percent: "100 (4)"
-    day_of_beating_range: "d8-d12"
-  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to cardiomyocytes and observed for initiation of beating starting at day 6. At ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD Biosciences) and gating was based on an isotype control. Ranges observed across multiple experiments are shown for Troponin T and Day of beating initiation; number of experiments is shown in (). "
----
+    troponin_percent_positive: 78.6 (1)
+    day_of_beating_percent: 100 (4)
+    day_of_beating_range: d8-d12
+  cardiomyocyte_differentiation_caption: "iPSCs were differentiated to
+    cardiomyocytes and observed for initiation of beating starting at day 6. At
+    ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD
+    Biosciences) and gating was based on an isotype control. Ranges observed
+    across multiple experiments are shown for Troponin T and Day of beating
+    initiation; number of experiments is shown in (). "
+---