From b0cfaed76dcdf5bdbe699646dde89e89f0d35367 Mon Sep 17 00:00:00 2001 From: John St John Date: Tue, 2 Jun 2026 15:26:34 -0700 Subject: [PATCH 01/10] Switch from static to faster/more modern dynamic inference engine for evo2 Signed-off-by: John St John --- .../examples/fine-tuning-tutorial.ipynb | 4 +- .../src/bionemo/evo2/models/evo2_provider.py | 243 +++++ .../evo2/models/megatron/hyena/engine.py | 13 +- .../evo2/models/megatron/hyena/hyena_block.py | 86 ++ .../evo2/models/megatron/hyena/hyena_layer.py | 46 +- .../evo2/models/megatron/hyena/hyena_mixer.py | 96 +- .../src/bionemo/evo2/run/infer.py | 857 ++++++++++++------ .../bionemo/evo2/run/infer_example_simple.py | 10 +- .../evo2/run/text_generation_controller.py | 555 ------------ .../tests/bionemo/evo2/run/test_infer.py | 468 +++++++--- .../tests/bionemo/evo2/test_evo2.py | 24 +- 11 files changed, 1414 insertions(+), 988 deletions(-) delete mode 100644 bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/text_generation_controller.py diff --git a/bionemo-recipes/recipes/evo2_megatron/examples/fine-tuning-tutorial.ipynb b/bionemo-recipes/recipes/evo2_megatron/examples/fine-tuning-tutorial.ipynb index e7a147f2ea..d2ba192931 100644 --- a/bionemo-recipes/recipes/evo2_megatron/examples/fine-tuning-tutorial.ipynb +++ b/bionemo-recipes/recipes/evo2_megatron/examples/fine-tuning-tutorial.ipynb @@ -1010,7 +1010,7 @@ "\n", "You can now run inference with:\n", " infer_evo2 --ckpt-dir pretraining_demo/evo2/checkpoints --prompt 'ATCGATCG' --max-new-tokens 100\n", - " predict_evo2 --ckpt-dir pretraining_demo/evo2/checkpoints --input-fasta --output-dir \n" + " predict_evo2 --ckpt-dir pretraining_demo/evo2/checkpoints --fasta --output-dir \n" ] } ], @@ -1030,7 +1030,7 @@ "\n", "print(\"\\nYou can now run inference with:\")\n", "print(f\" infer_evo2 --ckpt-dir {ckpt_dir} --prompt 'ATCGATCG' --max-new-tokens 100\")\n", - "print(f\" predict_evo2 --ckpt-dir {ckpt_dir} --input-fasta --output-dir \")" + "print(f\" predict_evo2 --ckpt-dir {ckpt_dir} --fasta --output-dir \")" ] }, { diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/evo2_provider.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/evo2_provider.py index ce4721634f..decc690108 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/evo2_provider.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/evo2_provider.py @@ -146,6 +146,248 @@ def reset(self): delattr(self, key) +# ============================================================================= +# Dynamic-inference Hyena state packing +# ============================================================================= + + +class _PackedHyenaSlotStateDict(dict): + """``id(module)`` -> packed-slot view map for Hyena recurrent state. + + Hyena ops read/write recurrent state through ``*_filter_state_dict`` attributes keyed + by ``id(module)``. This dict preserves that API while routing registered ids into + sub-slice views of the live ``DynamicInferenceContext`` Mamba state buffers: + ``mamba_conv_states[layer, slot]`` for the projection FIR ring and + ``mamba_ssm_states[layer, slot]`` for the layer mixer state. Unregistered ids fall + back to plain dict storage. + """ + + def __init__(self, kind: str): + super().__init__() + self._kind = kind + # id(module) -> view tensor (a sub-slice of the packed slot buffer). + self._views: dict = {} + + def register(self, module_id: int, view: "torch.Tensor") -> None: + """Register the packed-slot sub-slice view that backs ``module_id``.""" + self._views[module_id] = view + + def __setitem__(self, module_id, state): + view = self._views.get(module_id) + if view is None or state is None: + # Unregistered owner, or an explicit None clear (re-prefill seed wipe). + super().__setitem__(module_id, state) + return + if state.data_ptr() != view.data_ptr(): + # Prefill seed, or a realloc step branch returning a NEW tensor: copy into the + # packed view. The in-place step branch returns the view itself -> no-op copy. + if state.shape == view.shape: + view.copy_(state) + else: + # Short prefill can seed a FIR ring smaller than the allocated slot. Right-align + # the available tail so decode can use the fixed-size in-place ring immediately. + assert state.shape[:-1] == view.shape[:-1] and state.shape[-1] <= view.shape[-1], ( + f"packed {self._kind} seed shape {tuple(state.shape)} incompatible with ring view " + f"{tuple(view.shape)} (only the FIR ring last dim may be shorter)." + ) + view.zero_() + view[..., view.shape[-1] - state.shape[-1] :].copy_(state) + super().__setitem__(module_id, view) + + def reset_for_new_request(self) -> None: + """Drop dict entries so ``.get(id)`` returns None and the caller re-prefills.""" + super().clear() + + +def build_evo2_mamba_inference_state_config(model, *, conv_dtype=None, ssm_dtype=None): + """Build the mcore Mamba state config used by Evo2 dynamic inference. + + Evo2 Hyena layers expose two recurrent state slots per layer, matching the two slots + that ``DynamicInferenceContext`` allocates for hybrid Mamba models: ``conv_states`` + for the projection FIR ring and ``ssm_states`` for the layer mixer state. The + ``HyenaStack`` provides the uniform packed shapes and layer type list that mcore uses + to allocate those buffers and map layer numbers to state slots. + + The slot dtypes default to fp32 because Hyena decode recurrences run in fp32 and update + the packed sub-slice views in place. + + Args: + model: The Evo2 ``HyenaModel``. + conv_dtype: Override for the conv slot dtype (default ``torch.float32``). + ssm_dtype: Override for the ssm slot dtype (default ``torch.float32``). + + Returns: + A ``MambaInferenceStateConfig`` ready to pass as + ``InferenceConfig(mamba_inference_state_config=...)``. + """ + from megatron.core.inference.config import ( + MambaInferenceStateConfig, # lazy: heavy mcore import — keep evo2_provider importable without the full inference stack + ) + + decoder = model.decoder if hasattr(model, "decoder") else model + conv_states_shape, ssm_states_shape = decoder.mamba_state_shapes_per_request() + layer_type_list = decoder.layer_type_list # mcore symbols, set in HyenaStack.__init__ + return MambaInferenceStateConfig( + layer_type_list=list(layer_type_list), + conv_states_shape=tuple(conv_states_shape), + ssm_states_shape=tuple(ssm_states_shape), + conv_states_dtype=conv_dtype or torch.float32, + ssm_states_dtype=ssm_dtype or torch.float32, + ) + + +def make_evo2_dynamic_inference_context_cls(): + """Return mcore's ``DynamicInferenceContext`` class for Evo2 decode. + + Evo2 constrains each standalone decode context to the active request count and enables + decode-only CUDA graph dimensions, so the graph path does not need an Evo2-specific + context subclass. Keeping the exact mcore type also preserves mcore's CUDA graph + argument checks without runtime compatibility hooks. + + Returns: + The mcore ``DynamicInferenceContext`` class. + """ + from megatron.core.inference.contexts.dynamic_context import ( + DynamicInferenceContext, # lazy: heavy mcore import; keep evo2_provider importable without the full inference stack + ) + + return DynamicInferenceContext + + +def compute_evo2_paged_kv_buffer_size_gb( + model_config, + *, + mamba_state_config, + max_sequence_length: int, + max_requests: int, + block_size_tokens: int = 256, + safety_blocks: int = 2, +) -> float: + """Compute a right-sized ``buffer_size_gb`` for one Evo2 dynamic context. + + ``DynamicInferenceContext`` derives its KV block count from ``buffer_size_gb``. For + hybrid models in the installed mcore version, the no-``mamba_memory_ratio`` path uses + ``buffer_size_bytes // (block_size_bytes + mamba_states_memory_per_request)``. This + helper mirrors that arithmetic and returns the smallest buffer that covers + ``ceil(max_sequence_length / block_size_tokens) + 1 dummy + safety_blocks`` KV blocks. + + Args: + model_config: The Evo2 ``HyenaModel`` transformer config. + mamba_state_config: The ``MambaInferenceStateConfig`` produced by + :func:`build_evo2_mamba_inference_state_config`. + max_sequence_length: Prompt plus generation length to allocate for. + max_requests: The context's ``max_requests``. + block_size_tokens: KV block size used by the context. + safety_blocks: Extra KV blocks beyond the requested sequence length. + + Returns: + The ``buffer_size_gb`` value to pass to ``InferenceConfig``. + """ + # --- Per-partition attention geometry (mcore dynamic_context.py:285-299). --- + num_attention_heads = getattr(model_config, "num_query_groups", None) or model_config.num_attention_heads + kv_channels = getattr(model_config, "kv_channels", None) or ( + model_config.hidden_size // model_config.num_attention_heads + ) + projection_size = kv_channels * num_attention_heads + head_dim = projection_size // num_attention_heads + tp_size = int(getattr(model_config, "tensor_model_parallel_size", 1) or 1) + heads_per_partition = num_attention_heads // tp_size if num_attention_heads >= tp_size else 1 + + # --- Layer-type counts from the mamba state config's layer_type_list. --- + # Symbols.ATTENTION layers need paged KV; the Hyena ("mamba"-slotted) layers do NOT (they hold + # only the conv/ssm recurrent-state slots). Counting from layer_type_list keeps this correct + # under any (truncated) hybrid_override_pattern. + from megatron.core.ssm.mamba_hybrid_layer_allocation import ( # lazy: heavy mcore import — keep evo2_provider importable without the full inference stack + Symbols as _McoreSymbols, + ) + + layer_type_list = list(mamba_state_config.layer_type_list) + num_attention_layers = sum(1 for s in layer_type_list if s == _McoreSymbols.ATTENTION) + num_mamba_layers = sum(1 for s in layer_type_list if s == _McoreSymbols.MAMBA) + + # --- block_size_bytes (mcore dynamic_context.py:376-383). --- + kv_dtype_size_bytes = model_config.params_dtype.itemsize + block_size_bytes = ( + kv_dtype_size_bytes * 2 * num_attention_layers * block_size_tokens * heads_per_partition * head_dim + ) + + # --- mamba_states_memory_per_request (mcore dynamic_context.py:386-394). --- + conv_bytes = math.prod(mamba_state_config.conv_states_shape) * mamba_state_config.conv_states_dtype.itemsize + ssm_bytes = math.prod(mamba_state_config.ssm_states_shape) * mamba_state_config.ssm_states_dtype.itemsize + mamba_per_request = (conv_bytes + ssm_bytes) * num_mamba_layers + + # --- Target KV block count: requested sequence + dummy block + safety. --- + target_blocks = math.ceil(int(max_sequence_length) / block_size_tokens) + 1 + int(safety_blocks) + target_blocks = max(2, target_blocks) # mcore floors block_count at 2 (active + dummy) + + # --- Invert mcore's hybrid block-count formula for the no-mamba-ratio path. --- + total_bytes = target_blocks * (block_size_bytes + mamba_per_request) + return (total_bytes + 1) / (1024**3) + + +def bind_hyena_packed_views_to_dynamic_context(model, dyn_ctx, *, request_slot: int): + """Bind Hyena state-dict entries to a live ``DynamicInferenceContext`` Mamba slot. + + ``DynamicInferenceContext`` allocates ``mamba_conv_states`` and ``mamba_ssm_states`` + from the Evo2 Mamba state config. This function installs the Hyena ``*_filter_state_dict`` + dictionaries that route each layer's existing state writes into the assigned request slot: + the projection FIR ring uses the conv slot, and the layer mixer state uses the leading + sub-slice of the ssm slot. + + It must run after the request has been added and after ``initialize_all_tensors`` so the + mamba state buffers and request slot are available. The current standalone path binds one + request slot at a time; batched decode would need per-row state gathers in the Hyena step + kernels. + + Args: + model: The Evo2 ``HyenaModel``. + dyn_ctx: A live ``DynamicInferenceContext`` built with the Evo2 mamba state config. + request_slot: The mamba state slot assigned to the active request. + + Returns: + The installed ``_PackedHyenaSlotStateDict`` objects. + """ + decoder = model.decoder if hasattr(model, "decoder") else model + _conv_shape, _ssm_shape, per_layer = decoder.hyena_state_shapes_per_request() + + conv_states = dyn_ctx.mamba_conv_states # (num_mamba_layers, max_requests, *conv_shape) + ssm_states = dyn_ctx.mamba_ssm_states # (num_mamba_layers, max_requests, *ssm_shape) + layer_map = dyn_ctx.layer_map # global-0based -> per-type-local index + + # One packed dict per state-dict bucket the Hyena ops use, installed on the live context. + packed: dict = {} + for kind in ("fir", "inner_fir", "iir"): + d = _PackedHyenaSlotStateDict(kind) + packed[kind] = d + object.__setattr__(dyn_ctx, f"{kind}_filter_state_dict", d) + + # Iterate Hyena layers in the SAME order as ``per_layer`` (hyena_state_shapes_per_request + # walks ``decoder.layers`` skipping attention) and resolve each layer's mamba-local index via + # the context's layer_map so the conv/ssm sub-slice lands in the exact slot + # ``mamba_states_cache(layer_number)`` would return. + hyena_layers = [ + layer + for layer in decoder.layers + if hasattr(layer, "mixer") and hasattr(layer.mixer, "hyena_state_shapes_per_request") + ] + assert len(hyena_layers) == len(per_layer), ( + f"Hyena-layer/per-layer-shape count mismatch ({len(hyena_layers)} vs {len(per_layer)}); " + "hyena_state_shapes_per_request() and the layer walk disagree." + ) + for layer, shapes in zip(hyena_layers, per_layer): + mamba_layer_idx = layer_map[layer.layer_number - 1] + # conv slot: whole per-(layer,request) row, reshaped to [B=1, *conv_shape] for the op. + conv_row = conv_states[mamba_layer_idx, request_slot] # (*conv_shape) + conv_view = conv_row.unsqueeze(0) # [1, *conv_shape] — STABLE alias (no copy) + packed["fir"].register(shapes.conv_owner_id, conv_view) + # ssm slot: leading sub-slice of the row, reshaped to [B=1, :width, :last_dim]. + w, last = shapes.ssm_shape + ssm_view = ssm_states[mamba_layer_idx, request_slot, :w, :last].unsqueeze(0) # [1, w, last] + packed[shapes.ssm_kind].register(shapes.ssm_owner_id, ssm_view) + + return list(packed.values()) + + def get_batch( data_iterator: Iterable, cfg: ConfigContainer, use_mtp: bool = False, *, pg_collection ) -> tuple[ @@ -821,5 +1063,6 @@ def infer_model_type(model_size: str) -> str: "HyenaNV40bModelProvider", "HyenaNVTestModelProvider", "HyenaTestModelProvider", + "compute_evo2_paged_kv_buffer_size_gb", "infer_model_type", ] diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py index 9846363877..775c9a24f7 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py @@ -134,7 +134,9 @@ def parallel_fir( fir_state = None if compute_state: - fir_state = u[..., -fir_length + 1 :] + # Persistent fp32 buffer so step_fir's ``.to(float32)`` is a no-op and + # the in-place ring-buffer update preserves the dynamic-context alias. + fir_state = u[..., -fir_length + 1 :].to(torch.float32).contiguous() return z, fir_state @@ -205,9 +207,12 @@ def step_fir(*, u, fir_state, weight, bias=None, gated_bias=False, flip_filter=F # Update the state if cache_size < filter_length - 1: + # Growing the cache when the prompt is shorter than the FIR filter. fir_state = torch.cat([fir_state, u[..., None]], dim=-1) else: - fir_state = torch.roll(fir_state, -1, dims=2) + # In-place ring-buffer shift on the persistent fp32 buffer. The ``torch.roll`` + # temporary is copied back into the dynamic-context state slot. + fir_state.copy_(torch.roll(fir_state, -1, dims=2)) fir_state[..., -1] = u return y.to(input_dtype), fir_state @@ -219,7 +224,9 @@ def step_iir(*, x2, x1, v, D, residues, poles, iir_state): # noqa: N803 poles = torch.exp(poles) # poles arg contains log_poles poles = poles[..., 0][None] # squeeze dummy seqlen dim and add dummy batch dim residues = residues[None] # add dummy batch dim - iir_state = poles * iir_state + x1v[..., None] + # In-place recurrence on the persistent IIR state buffer. Same math as the + # reallocating update: ``iir_state = poles * iir_state + x1v[..., None]``. + iir_state.mul_(poles).add_(x1v[..., None]) res_state = torch.sum(residues * iir_state, dim=-1) y = x2 * (res_state + D * x1v) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_block.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_block.py index ac03b7a999..4da2be82ff 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_block.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_block.py @@ -208,6 +208,23 @@ def __init__( else: assert True, "unexpected layer_type" self.layers.append(layer) + + # Per-(pipeline-rank) layer-type list in the SAME local order as ``self.layers``, + # expressed in mcore's hybrid-allocation symbols so it is drop-in for + # ``MambaInferenceStateConfig.from_model`` (which reads ``decoder.layer_type_list`` and + # routes ``Symbols.MAMBA``/``Symbols.ATTENTION`` to the mamba/KV slots — see + # ``megatron/core/inference/config.py:56`` and ``dynamic_context.py:339``). Every Hyena + # operator (short/medium/long) is a single recurrent "mamba"-slotted layer, so all three + # Evo2 symbols (S/D/H) map to ``Symbols.MAMBA`` ("M") and attention ("*") stays ATTENTION. + # Dynamic inference uses this to map Evo2 Hyena layers onto mcore's Mamba state + # slots and attention layers onto paged-KV slots. Training does not read it. + from megatron.core.ssm.mamba_hybrid_layer_allocation import ( # lazy: heavy mcore import — keep hyena_block importable in CPU unit tests/CLI + Symbols as _McoreSymbols, + ) + + self.layer_type_list = [ + _McoreSymbols.MAMBA if sym in HYENA_LAYER_MAP else _McoreSymbols.ATTENTION for sym in layer_type_list + ] if self.post_process and self.post_layer_norm: # Final layer norm before output. self.final_norm = TENorm( @@ -232,6 +249,75 @@ def set_input_tensor(self, input_tensor: Tensor): """ self.input_tensor = input_tensor + def hyena_state_shapes_per_request(self): + """Common (conv, ssm) per-request decode-state shapes across all Hyena layers. + + The Hyena analog of mcore's ``decoder.mamba_state_shapes_per_request()`` (consumed by + ``MambaInferenceStateConfig.from_model`` at ``megatron/core/inference/config.py:58``). + The dynamic context allocates exactly ONE ``(conv_states_shape, ssm_states_shape)`` for + all Hyena ("mamba"-slotted) layers — buffers are ``(num_layers, max_requests, *shape)`` + (``dynamic_context.py:744``) — so this returns a UNIFORM pair that all Hyena layers fit: + + * **conv_states_shape** — the ``hyena_proj_conv`` FIR ring shape. Asserted identical + across every Hyena layer (it is: same proj geometry per TP rank). If a future + override pattern mixed proj widths this assert would fire (a real, important finding + rather than silent corruption). + * **ssm_states_shape** — the per-type mixer state padded to the elementwise MAX over + all Hyena layers: ``(max(width), max(last_dim))`` where ``last_dim`` is + ``K_short-1`` / ``K_medium-1`` / ``order`` per type. Each layer writes into the + leading sub-slice ``[:width, :last_dim]`` of its slot; the unused tail stays zero and + is never read (``engine.step_fir``/``step_iir`` index by the live state's own shape). + + Returns: + Tuple ``(conv_states_shape, ssm_states_shape, per_layer)`` where ``per_layer`` is a + list of :class:`~bionemo.evo2.models.megatron.hyena.hyena_mixer.HyenaMixerStateShapes` + in layer order (Hyena layers only), used by the packed-slot adapter to know each + layer's exact (un-padded) sub-slice + owner ids. ``conv/ssm`` shapes are + per-request (no batch / max_requests dim). + + Raises: + ValueError: if there are no Hyena layers on this rank, or if the per-layer + ``hyena_proj_conv`` conv shapes are not identical (the uniformity invariant + the single-shape allocation depends on). + """ + per_layer = [] + conv_shapes = set() + ssm_widths = [] + ssm_last_dims = [] + for layer in self.layers: + if not hasattr(layer, "mixer") or not hasattr(layer.mixer, "hyena_state_shapes_per_request"): + continue # attention layer (or any non-Hyena layer): no recurrent Hyena state + shapes = layer.mixer.hyena_state_shapes_per_request() + per_layer.append(shapes) + conv_shapes.add(tuple(shapes.conv_shape)) + ssm_widths.append(shapes.ssm_shape[0]) + ssm_last_dims.append(shapes.ssm_shape[1]) + + if not per_layer: + raise ValueError("hyena_state_shapes_per_request(): no Hyena layers found on this rank") + if len(conv_shapes) != 1: + raise ValueError( + "Option-A packing requires a uniform hyena_proj_conv state shape across Hyena " + f"layers, but found {sorted(conv_shapes)}. The dynamic context allocates one " + "conv_states_shape for all layers; per-layer conv widths are unsupported." + ) + conv_states_shape = next(iter(conv_shapes)) + ssm_states_shape = (max(ssm_widths), max(ssm_last_dims)) + return conv_states_shape, ssm_states_shape, per_layer + + def mamba_state_shapes_per_request(self): + """``(conv_states_shape, ssm_states_shape)`` — drop-in for mcore's Mamba accessor. + + Signature/return match ``megatron.core.ssm.mamba_mixer`` ``decoder.mamba_state_shapes_per_request()`` + (the 2-tuple ``MambaInferenceStateConfig.from_model`` consumes at + ``megatron/core/inference/config.py:58``) so a ``DynamicInferenceContext`` built for Evo2 + allocates its two per-(layer,request) slots from the SAME uniform Hyena shapes the + Option-A packing uses. Delegates to :meth:`hyena_state_shapes_per_request` and drops the + per-layer detail (only needed by the packed-slot adapter, not by the context allocator). + """ + conv_states_shape, ssm_states_shape, _ = self.hyena_state_shapes_per_request() + return conv_states_shape, ssm_states_shape + def _select_layers_for_pipeline_parallel(self, layer_type_list): pipeline_rank = self.pg_collection.pp.rank() if self.pg_collection.pp is not None else 0 num_layers_per_pipeline_rank = self.transformer_config.num_layers // ( diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_layer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_layer.py index 577bf9af2a..22f1d3f939 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_layer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_layer.py @@ -23,8 +23,9 @@ from megatron.core.inference.contexts import BaseInferenceContext from megatron.core.packed_seq_params import PackedSeqParams from megatron.core.process_groups_config import ProcessGroupCollection +from megatron.core.transformer.enums import CudaGraphScope from megatron.core.transformer.identity_op import IdentityOp -from megatron.core.transformer.module import MegatronModule +from megatron.core.transformer.module import GraphableMegatronModule from megatron.core.transformer.spec_utils import ModuleSpec, build_module from megatron.core.transformer.transformer_config import TransformerConfig from megatron.core.utils import deprecate_inference_params @@ -46,8 +47,14 @@ class HyenaLayerSubmodules: mlp_bda: Union[ModuleSpec, type] = IdentityOp -class HyenaLayer(MegatronModule): - """Top level Hyena Layer.""" +class HyenaLayer(GraphableMegatronModule): + """Top level Hyena Layer. + + Subclasses :class:`GraphableMegatronModule` so Hyena layers can participate in + mcore's per-layer local CUDA graph capture during inference decode. The graph machinery + only activates when the model is built with ``cuda_graph_impl='local'``; otherwise + this behaves exactly like the previous ``MegatronModule`` subclass. + """ def __init__( self, @@ -102,6 +109,39 @@ def __init__( if hasattr(layer, "set_layer_number"): layer.set_layer_number(self.layer_number) + def create_mcore_cudagraph_manager(self, config): + """Register this Hyena layer for local CUDA graphs. + + Mirrors :meth:`MambaLayer.create_mcore_cudagraph_manager`: an empty + ``cuda_graph_scope`` captures the whole layer, while ``CudaGraphScope.mamba`` + can be used by callers that only want the recurrent/mixer scope. + """ + from megatron.core.transformer.cuda_graphs import CudaGraphManager # lazy: heavy mcore import + + if not self.config.cuda_graph_scope or CudaGraphScope.mamba in (self.config.cuda_graph_scope or []): + self.cudagraph_manager = CudaGraphManager(config) + + def _should_call_local_cudagraph(self, *args, **kwargs): + """Check whether this Hyena layer should use mcore local CUDA graphs.""" + if ( + hasattr(self, "cudagraph_manager") + and kwargs.get("inference_context") is None + and not torch.is_inference_mode_enabled() + ): + return True + if ( + not self.training + and hasattr(self, "cudagraph_manager") + and kwargs.get("attention_mask") is None + and kwargs.get("inference_context") is not None + and (not self.config.cuda_graph_scope or CudaGraphScope.mamba in self.config.cuda_graph_scope) + ): + context = kwargs["inference_context"] + if context.is_static_batching(): + return bool(context.is_decode_only()) + return bool(context.using_cuda_graph_this_step()) + return False + @property def bias_dropout_add_exec_handler(self): """Return the appropriate execution handler for the current mode.""" diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py index 81271c8e47..3d21cf37ba 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py @@ -91,6 +91,30 @@ class HyenaMixerSubmodules: dense: Union[ModuleSpec, type] = None +@dataclass +class HyenaMixerStateShapes: + """Per-request recurrent decode-state layout for one Hyena mixer. + + Returned by :meth:`HyenaMixer.hyena_state_shapes_per_request`. Describes the two + recurrent states every Hyena layer carries during decode, which dynamic inference packs + into the context's two Mamba slots: + + * ``conv_*`` — the ``hyena_proj_conv`` FIR ring (uniform across all Hyena layer types). + * ``ssm_*`` — the operator's single mixer state, whose shape/kind varies by operator + type (``fir`` for short, ``inner_fir`` for medium, ``iir`` for long). + + ``*_owner_id`` are the ``id(module)`` keys the Hyena ops use to index their + ``*_filter_state_dict`` (see ``hyena_utils.update_filter_state``/``get_filter_state``); + the packed-slot adapter routes those exact ids to the dynamic context slots. + """ + + conv_shape: tuple # (proj_channels, K_proj - 1) + conv_owner_id: int # id(self.hyena_proj_conv) + ssm_shape: tuple # (width, K_mixer - 1) for FIR, or (width, order) for IIR + ssm_kind: str # "fir" | "inner_fir" | "iir" -> the *_filter_state_dict bucket + ssm_owner_id: int # id(mixer.short_conv) for short, else id(mixer) + + class HyenaMixer(MegatronModule): """A class for the HyenaMixer.""" @@ -277,6 +301,72 @@ def sharded_state_dict(self, prefix="", sharded_offsets=(), metadata=None): return sharded_state_dict + def hyena_state_shapes_per_request(self) -> "HyenaMixerStateShapes": + """Per-request recurrent decode-state shapes for this Hyena mixer. + + The Hyena analog of :meth:`megatron.core.ssm.mamba_mixer.MambaMixer.mamba_state_shapes_per_request` + (mcore ``mamba_mixer.py:1195``). Every Hyena layer — regardless of operator type + (``hyena_short_conv`` / ``hyena_medium_conv`` / ``hyena``) — carries **exactly two** + recurrent states during decode, mirroring Mamba's ``(conv_state, ssm_state)`` slots: + + 1. **conv slot** — the FIR ring buffer of ``self.hyena_proj_conv`` (the shared input + projection conv present in *all* Hyena layer types). Stored eagerly under + ``inference_context.fir_filter_state_dict[id(self.hyena_proj_conv)]`` with shape + ``(B, proj_channels, K_proj-1)`` (see ``hyena_utils.ParallelCausalDepthwiseConv1dWithState.forward`` + and ``engine.parallel_fir``). Per-request shape (drop B): ``(proj_channels, K_proj-1)``. + + 2. **ssm slot** — the operator's single mixer state, which *differs in shape and kind* + by operator type: + * ``hyena_short_conv``: FIR ring of ``mixer.short_conv``, key ``fir`` keyed by + ``id(mixer.short_conv)``, shape ``(width, K_short-1)``. + * ``hyena_medium_conv``: FIR ring of the operator, key ``inner_fir`` keyed by + ``id(mixer)``, shape ``(width, K_medium-1)``. + * ``hyena`` (long): the IIR pole-recurrence of the operator, key ``iir`` keyed by + ``id(mixer)``, shape ``(width, order)``. NOTE: in *this* Evo2 implementation the + IIR state is **real fp32, not complex** — the poles ``p``/``gamma`` are real + params and ``engine.step_iir`` does ``exp(real_log_poles) * iir_state`` (real), + while the prefill seed ``engine.prefill_via_modal_fft`` explicitly drops the + imaginary part via ``.to(torch.float32)`` (engine.py:281). So NO 2x-real + expansion is needed; ``order`` real slots suffice. + + Both states are kept fp32 because the decode recurrences in ``engine.step_fir`` and + ``engine.step_iir`` run in fp32. The caller (:meth:`HyenaStack.hyena_state_shapes_per_request`) + pads each layer's mixer state up to a common ``ssm_states_shape`` so the dynamic + context can allocate one uniform shape across all Hyena ("mamba") layers. + + Returns: + HyenaMixerStateShapes with this layer's conv/ssm per-request shapes + the + owner ids + the state-dict key for the ssm slot. + """ + proj_channels = self.hyena_proj_conv.short_conv_weight.shape[0] * self.hyena_proj_conv.group_dim + conv_shape = (proj_channels, self.hyena_proj_conv.kernel_size - 1) + + if self.operator_type == "hyena_short_conv": + width = self.mixer.short_conv.d_model + ssm_shape = (width, self.mixer.short_conv.kernel_size - 1) + ssm_kind = "fir" + ssm_owner = self.mixer.short_conv + elif self.operator_type == "hyena_medium_conv": + width = self.mixer.width_per_tp_group + ssm_shape = (width, self.mixer.kernel_size - 1) + ssm_kind = "inner_fir" + ssm_owner = self.mixer + elif self.operator_type == "hyena": + width = self.mixer.width_per_tp_group + ssm_shape = (width, self.hyena_config.hyena_filter_order) + ssm_kind = "iir" + ssm_owner = self.mixer + else: + raise ValueError(f"Unsupported operator_type for native dynamic inference: {self.operator_type}") + + return HyenaMixerStateShapes( + conv_shape=conv_shape, + conv_owner_id=id(self.hyena_proj_conv), + ssm_shape=ssm_shape, + ssm_kind=ssm_kind, + ssm_owner_id=id(ssm_owner), + ) + def forward(self, x, layer_past=None, inference_context=None, _hyena_use_cp=True): """Applies the Hyena sequence mixing operation to input embeddings. @@ -349,7 +439,9 @@ def _populate_b2b_inference_state(self, features, inference_context): proj_kernel_size = self.hyena_proj_conv.kernel_size # (a) proj_conv FIR state: input tail in [B, D, K_proj-1] - proj_state = features[..., -(proj_kernel_size - 1) :].contiguous() + # fp32 persistent buffer so step_fir's ``.to(float32)`` is a no-op and the + # in-place ring-buffer shift preserves the dynamic-context alias. + proj_state = features[..., -(proj_kernel_size - 1) :].to(torch.float32).contiguous() proj_dict = getattr(inference_context, "fir_filter_state_dict", {}) proj_dict[id(self.hyena_proj_conv)] = proj_state setattr(inference_context, "fir_filter_state_dict", proj_dict) @@ -381,7 +473,7 @@ def _populate_b2b_inference_state(self, features, inference_context): x1, x2, v = rearrange(intermediate, "b (g dg p) l -> b (g dg) p l", p=3, g=self.num_groups_per_tp_rank).unbind( dim=2 ) - mixer_input_tail = (x2 * v).contiguous() # [B, D, K_mixer-1] + mixer_input_tail = (x2 * v).to(torch.float32).contiguous() # [B, D, K_mixer-1] if self.operator_type == "hyena_short_conv": mixer_state_owner_id = id(self.mixer.short_conv) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py index 0b5f418710..5e61c90f1b 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py @@ -18,10 +18,11 @@ r"""Text generation (inference) workflow for Evo2 using Megatron Core. -This module provides autoregressive text generation for Evo2 models using the -MCore inference infrastructure (StaticInferenceEngine, TextGenerationController). - -Based on: https://github.com/NVIDIA/Megatron-LM/blob/main/examples/inference/gpt/gpt_static_inference.py +This module provides autoregressive text generation for Evo2 models through the native mcore +dynamic-inference engine. It drives paged-KV attention with Hyena recurrent state packed into +mcore's two Mamba state slots. ``flash_decode`` and sequence parallelism are turned off +automatically, and each prompt is decoded through an Evo2-specific dynamic context that keeps a +single active request as one row. Usage (CLI, single prompt): torchrun --nproc_per_node 1 -m bionemo.evo2.run.infer \ @@ -58,8 +59,8 @@ """ import argparse +import contextlib import gc -import inspect import json import logging import os @@ -94,47 +95,18 @@ from megatron.bridge.utils.common_utils import get_world_size_safe from megatron.bridge.utils.instantiate_utils import instantiate from megatron.core import dist_checkpointing, parallel_state -from megatron.core.inference.contexts import StaticInferenceContext -from megatron.core.inference.engines.static_engine import StaticInferenceEngine -from megatron.core.inference.model_inference_wrappers.abstract_model_inference_wrapper import ( - AbstractModelInferenceWrapper, -) - - -try: - from megatron.core.inference.model_inference_wrappers.inference_wrapper_config import ( - InferenceWrapperConfig, - ) -except ImportError: - - @dataclass - class InferenceWrapperConfig: - """Compatibility shim for MCore versions that removed InferenceWrapperConfig.""" - - hidden_size: int - inference_max_requests: int - inference_max_seq_length: int - inference_batch_times_seqlen_threshold: int - params_dtype: torch.dtype - padded_vocab_size: int - nccl_all_reduce_for_prefill: bool = False - moe_pad_experts_for_cuda_graph_inference: bool = False - - def add_attributes(self, attributes: dict[str, Any]) -> None: - """Match the old MCore config helper used by Evo2TextGenerationController.""" - for name, value in attributes.items(): - setattr(self, name, value) - - from megatron.core.inference.sampling_params import SamplingParams from megatron.core.transformer.module import Float16Module -from megatron.core.utils import get_model_config from bionemo.evo2.data.dataset_tokenizer import DEFAULT_HF_TOKENIZER_MODEL_PATH -from bionemo.evo2.models.evo2_provider import HyenaInferenceContext +from bionemo.evo2.models.evo2_provider import ( + bind_hyena_packed_views_to_dynamic_context, + build_evo2_mamba_inference_state_config, + compute_evo2_paged_kv_buffer_size_gb, + make_evo2_dynamic_inference_context_cls, +) from bionemo.evo2.models.megatron.hyena.subquadratic_safety import ensure_subquadratic_ops_supported from bionemo.evo2.run.predict import initialize_inference_distributed, resolve_checkpoint_path -from bionemo.evo2.run.text_generation_controller import Evo2TextGenerationController logger: logging.Logger = logging.getLogger(__name__) @@ -150,51 +122,20 @@ def _register_bionemo_target_prefix() -> None: pass -_WRAPPER_INIT_ACCEPTS_CONFIG = ( - "inference_wrapper_config" in inspect.signature(AbstractModelInferenceWrapper.__init__).parameters -) - - -class _TextGenerationTokenizerAdapter: - """Expose the tokenizer methods expected by MCore's static text-generation path.""" - - def __init__(self, tokenizer: _HuggingFaceTokenizer): - self._tokenizer = tokenizer +def _adapt_tokenizer_for_generation(tokenizer: Any) -> Any: + """Normalize tokenizer method names used by the dynamic-engine generation path. - def __getattr__(self, name: str) -> Any: - return getattr(self._tokenizer, name) - - @property - def vocab_size(self) -> int: - return self._tokenizer.vocab_size - - @property - def bos(self) -> Optional[int]: - return getattr(self._tokenizer, "bos", getattr(self._tokenizer, "bos_id", None)) - - @property - def eod(self) -> Optional[int]: - return getattr(self._tokenizer, "eod", None) - - def tokenize(self, text: str) -> list[int]: - if hasattr(self._tokenizer, "tokenize"): - return self._tokenizer.tokenize(text) - return self._tokenizer.text_to_ids(text) - - def detokenize(self, tokens: list[int], skip_special_tokens: bool = True) -> str: - if hasattr(self._tokenizer, "detokenize"): - return self._tokenizer.detokenize(tokens, skip_special_tokens=skip_special_tokens) - return self._tokenizer.ids_to_text(tokens) - - def offsets(self, tokens: list[int], text: str) -> list[int]: - if hasattr(self._tokenizer, "offsets"): - return self._tokenizer.offsets(tokens, text) - offsets = [] - position = 0 - for token in tokens: - offsets.append(position) - position += len(self.detokenize([token], skip_special_tokens=False)) - return offsets + Different mcore tokenizer backends expose ``tokenize``/``detokenize`` (HF-style) or + ``text_to_ids``/``ids_to_text``; :func:`_generate_native_dynamic` calls the former, so + alias them when only the latter exist. + """ + if not hasattr(tokenizer, "tokenize") and hasattr(tokenizer, "text_to_ids"): + tokenizer.tokenize = tokenizer.text_to_ids + if not hasattr(tokenizer, "detokenize") and hasattr(tokenizer, "ids_to_text"): + tokenizer.detokenize = tokenizer.ids_to_text + if not hasattr(tokenizer, "bos") and hasattr(tokenizer, "bos_id"): + tokenizer.bos = tokenizer.bos_id + return tokenizer # ============================================================================= @@ -300,138 +241,169 @@ def _prune_caches() -> None: # ============================================================================= -# Evo2 Model Inference Wrapper +# Inference Components Container # ============================================================================= -class Evo2ModelInferenceWrapper(AbstractModelInferenceWrapper): - """Inference wrapper for Evo2 models. +@dataclass +class Evo2InferenceComponents: + """Container for Evo2 inference components. - Extends the abstract wrapper to provide Evo2-specific input preparation - and forward pass handling for autoregressive text generation. + This dataclass holds everything needed for text generation, making it easy to pass around + and reuse. Generation is driven through the native mcore dynamic-inference engine (paged KV + + Hyena state packed into mcore's Mamba slots); see :class:`Evo2NativeDynamicComponents` and + :func:`_generate_native_dynamic`. """ - def __init__( - self, - model: torch.nn.Module, - inference_wrapper_config: InferenceWrapperConfig, - inference_context: Optional[StaticInferenceContext] = None, - ): - """Initialize the Evo2 inference wrapper. - - Args: - model: The Evo2 model to wrap for inference. - inference_wrapper_config: Configuration with hidden size, vocab size, etc. - inference_context: Context for managing state and sequence offsets. - """ - self.inference_wrapper_config = inference_wrapper_config - if _WRAPPER_INIT_ACCEPTS_CONFIG: - super().__init__(model, inference_wrapper_config, inference_context) - else: - super().__init__(model, inference_context) - - def prep_inference_input(self, prompts_tokens: torch.Tensor) -> Dict[str, Any]: - """Prepare the inference input data. - - Args: - prompts_tokens: A tensor of shape [batch_size, max_seq_len] - - Returns: - Dict with tokens, attention_mask, and position_ids - """ - batch_size, seq_len = prompts_tokens.shape - device = prompts_tokens.device - - # For Evo2/Hyena models, position_ids are sequential - position_ids = torch.arange(seq_len, dtype=torch.long, device=device).unsqueeze(0).expand(batch_size, -1) - - # Evo2 uses causal attention - for flash attention backend, mask is None - attention_mask = None - - return { - "tokens": prompts_tokens, - "attention_mask": attention_mask, - "position_ids": position_ids, - } - - def get_batch_for_context_window( - self, - inference_input: Dict[str, Any], - context_start_position: int, - context_end_position: int, - ) -> Dict[str, Any]: - """Extract batch for a specific context window. - - Called iteratively during autoregressive generation. - - Args: - inference_input: Full inference input dict - context_start_position: Start of context window - context_end_position: End of context window - - Returns: - Dict with sliced tokens, positions, and attention mask - """ - tokens = inference_input["tokens"] - position_ids = inference_input["position_ids"] - attention_mask = inference_input["attention_mask"] - - tokens2use = tokens[:, context_start_position:context_end_position] - positions2use = position_ids[:, context_start_position:context_end_position] - - if attention_mask is not None: - attention_mask2use = attention_mask[ - ..., context_start_position:context_end_position, :context_end_position - ] - else: - attention_mask2use = None - - return { - "tokens": tokens2use, - "position_ids": positions2use, - "attention_mask": attention_mask2use, - } - - def _forward(self, inference_input: Dict[str, Any]) -> torch.Tensor: - """Run a forward pass of the model. - - Args: - inference_input: The input data dict. - - Returns: - The model output logits. - """ - tokens = inference_input["tokens"] - position_ids = inference_input["position_ids"] - attention_mask = inference_input["attention_mask"] - - return self.model( - tokens, - position_ids, - attention_mask, - inference_context=self.inference_context, - runtime_gather_output=True, - ) + tokenizer: _HuggingFaceTokenizer + model: torch.nn.Module + native_dynamic: "Evo2NativeDynamicComponents" + + +@dataclass +class Evo2NativeDynamicComponents: + """Components for driving Evo2 generation on the native mcore dynamic engine. + + Holds the dynamic-context subclass, Evo2 Mamba state config, and standalone + HyenaModel used by text generation. The per-request lifecycle + (``add_request`` -> :func:`bind_hyena_packed_views_to_dynamic_context` -> + ``initialize_attention_state`` -> forward -> sample -> ``update_requests``) runs + in :func:`_generate_native_dynamic`. + """ + + ctx_cls: type + mamba_state_config: Any + forward_model: torch.nn.Module + hyena_model: torch.nn.Module + max_seq_length: int + cuda_graphs_enabled: bool + cuda_graph_manager_count: int # ============================================================================= -# Inference Components Container +# Native dynamic-inference engine wiring # ============================================================================= -@dataclass -class Evo2InferenceComponents: - """Container for Evo2 inference components. +def _unwrap_hyena_model(model: torch.nn.Module) -> torch.nn.Module: + """Return the underlying HyenaModel from a (possibly Float16Module-wrapped) model. - This dataclass holds all the components needed for text generation, - making it easy to pass around and reuse. + The native-dynamic helpers (state-shape probing, view binding) need the real + ``HyenaModel`` whose ``decoder`` exposes ``hyena_state_shapes_per_request`` / + ``mamba_state_shapes_per_request`` and whose layer ``id(module)`` values match the + modules the Hyena ops touch at runtime. """ + inner = getattr(model, "module", model) + return inner + + +def _setup_native_dynamic_components( + *, + model: torch.nn.Module, + raw_model: torch.nn.Module, + max_seq_length: int, + cuda_graphs_enabled: bool, +) -> Evo2NativeDynamicComponents: + """Prepare the standalone HyenaModel to decode on an Evo2 dynamic context. + + This disables sequence parallelism for the Evo2 model, builds the exact-rounding + ``DynamicInferenceContext`` subclass, and creates the Mamba state config that lets mcore + allocate Hyena recurrent state in its dynamic state buffers. Per-prompt contexts are built + lazily in :func:`_generate_native_dynamic` so each request can be sized to its prompt and + requested generation length. + """ + rank = int(os.environ.get("RANK", "0")) + hyena_model = _unwrap_hyena_model(model) + + # Sequence-parallel off keeps the context's single active request as one row. + if getattr(hyena_model.config, "sequence_parallel", False): + try: + from megatron.core.transformer.utils import ( + set_model_to_sequence_parallel, # lazy: heavy mcore import + ) + + set_model_to_sequence_parallel(hyena_model, False) + except Exception as exc: # pragma: no cover - defensive + if rank == 0: + logger.warning("[evo2-native] set_model_to_sequence_parallel failed: %r", exc) + hyena_model.config.sequence_parallel = False + + ctx_cls = make_evo2_dynamic_inference_context_cls() + mamba_cfg = build_evo2_mamba_inference_state_config(raw_model) + cuda_graph_manager_count = sum(1 for module in hyena_model.modules() if hasattr(module, "cudagraph_manager")) + if rank == 0: + logger.info( + "[evo2-native] standalone evo2 prepared for native dynamic decode " + "(SP off, cuda_graphs=%s, graph_managers=%d).", + cuda_graphs_enabled, + cuda_graph_manager_count, + ) + return Evo2NativeDynamicComponents( + ctx_cls=ctx_cls, + mamba_state_config=mamba_cfg, + forward_model=model, + hyena_model=hyena_model, + max_seq_length=max_seq_length, + cuda_graphs_enabled=cuda_graphs_enabled, + cuda_graph_manager_count=cuda_graph_manager_count, + ) + + +def _configure_native_dynamic_cuda_graphs(model_provider: Any, *, rank: int) -> bool: + """Enable mcore local CUDA graphs for Evo2 dynamic inference when supported. + + This mirrors Megatron's ``cuda_graph_impl=local`` setup, but applies it directly to the + provider loaded from the checkpoint because this recipe does not use Megatron's global arg + parser. Empty ``cuda_graph_scope`` means per-layer local graph capture for every graphable + layer; Evo2's HyenaLayer follows the same convention as mcore's MambaLayer. + """ + if not hasattr(model_provider, "cuda_graph_impl"): + if rank == 0: + logger.warning("[evo2-native-cg] model provider has no cuda_graph_impl; CUDA graphs disabled") + return False + + model_provider.cuda_graph_impl = "local" + model_provider.cuda_graph_scope = [] + os.environ.setdefault("NCCL_GRAPH_REGISTER", "0") + if rank == 0: + logger.info("[evo2-native-cg] enabled mcore local per-layer CUDA graphs for dynamic decode") + return True + + +def _seed_cudagraph_safe_rng(rng_config: Any) -> None: + """Re-seed Megatron's CUDA RNG tracker in graph-safe mode before graphable layers build.""" + from megatron.core.tensor_parallel.random import model_parallel_cuda_manual_seed + + seed = int(rng_config.seed) + (100 * parallel_state.get_pipeline_model_parallel_rank()) + if getattr(rng_config, "data_parallel_random_init", False): + seed += 10 * parallel_state.get_data_parallel_rank() + model_parallel_cuda_manual_seed( + seed, + getattr(rng_config, "te_rng_tracker", False), + getattr(rng_config, "inference_rng_tracker", False), + use_cudagraphable_rng=True, + force_reset_rng=True, + ) + if int(os.environ.get("RANK", "0")) == 0: + logger.info("[evo2-native-cg] re-seeded graph-safe CUDA RNG tracker (seed=%d)", seed) + + +def _teardown_distributed_for_inference() -> None: + """Release Megatron and torch distributed state for non-forced inference exits.""" + if torch.cuda.is_available(): + torch.cuda.synchronize() + if parallel_state.model_parallel_is_initialized(): + parallel_state.destroy_model_parallel() + if dist.is_initialized(): + dist.destroy_process_group() - inference_engine: StaticInferenceEngine - tokenizer: _HuggingFaceTokenizer - inference_wrapper: Evo2ModelInferenceWrapper - inference_context: StaticInferenceContext - model: torch.nn.Module + +def _force_exit_after_cuda_graph_inference() -> None: + """Bypass torchrun/NCCL atexit teardown after CUDA graph inference.""" + logger.info("[evo2-native-cg] forcing process exit after CUDA graph inference") + sys.stdout.flush() + sys.stderr.flush() + os._exit(0) # ============================================================================= @@ -450,13 +422,14 @@ def setup_inference_engine( mixed_precision_recipe: Optional[str] = None, vortex_style_fp8: bool = False, random_seed: int = 1234, - prompt_segmentation_threshold: Optional[int] = None, use_subquadratic_ops: bool = False, ) -> Evo2InferenceComponents: - """Setup the Evo2 inference engine and related components. + """Setup the Evo2 native dynamic-inference engine and related components. - This function loads the model, creates the inference wrapper, and sets up - all necessary components for text generation. + Loads the model, wires it onto the native mcore dynamic-inference engine (paged-KV attention + + Hyena recurrent state packed into mcore's two Mamba slots), and returns everything needed for + text generation. ``flash_decode`` and sequence-parallel are turned off automatically (both + required by the dynamic path). Args: ckpt_dir: Path to MBridge checkpoint directory. @@ -469,10 +442,6 @@ def setup_inference_engine( vortex_style_fp8: Use vortex-style FP8 (applies FP8 only to projection layers). Needed for FP8-sensitive checkpoints from original evo2 training (1b, 40b). random_seed: Random seed for reproducibility. - prompt_segmentation_threshold: If set, prompts longer than this are - segmented during prefill to reduce peak memory. The first segment - runs as a normal prefill; remaining tokens are processed one at a - time before generation begins. use_subquadratic_ops: Use fused subquadratic-ops kernels (b2b causal conv1d in prefill, fft_causal_conv1d / causal_conv1d in parallel_fir). @@ -487,6 +456,8 @@ def setup_inference_engine( # ------------------------------------------------------------------------- # Step 1: Load configuration from checkpoint # ------------------------------------------------------------------------- + _register_bionemo_target_prefix() + resolved_ckpt_dir = resolve_checkpoint_path(ckpt_dir) logger.info(f"Loading configuration from checkpoint: {resolved_ckpt_dir}") @@ -495,7 +466,6 @@ def setup_inference_engine( raise FileNotFoundError(f"run_config.yaml not found at {run_config_filename}") run_config = read_run_config(run_config_filename) - _register_bionemo_target_prefix() model_provider = instantiate(run_config["model"]) logger.info(f"Instantiated model provider: {type(model_provider).__name__}") @@ -509,8 +479,17 @@ def setup_inference_engine( # does not support it for non-MoE models. model_provider.sequence_parallel = False - model_provider.flash_decode = True + # The native dynamic engine drives paged flash-attn-varlen itself and asserts NOT + # static-batching, so flash_decode (which asserts static batching, attention.py) MUST be off. + model_provider.flash_decode = False model_provider.use_subquadratic_ops = use_subquadratic_ops + cuda_graphs_enabled = _configure_native_dynamic_cuda_graphs(model_provider, rank=int(os.environ.get("RANK", "0"))) + if cuda_graphs_enabled and getattr(model_provider, "recompute_granularity", None): + logger.info("Disabling activation recompute for inference CUDA graphs") + model_provider.recompute_granularity = None + if getattr(model_provider, "fp32_residual_connection", False): + logger.info("Disabling fp32_residual_connection for inference to keep TE activations in params_dtype") + model_provider.fp32_residual_connection = False if vortex_style_fp8: model_provider.vortex_style_fp8 = True @@ -532,7 +511,7 @@ def setup_inference_engine( tokenizer = _HuggingFaceTokenizer(tokenizer_dir) else: tokenizer = _HuggingFaceTokenizer(DEFAULT_HF_TOKENIZER_MODEL_PATH) - tokenizer = _TextGenerationTokenizerAdapter(tokenizer) + tokenizer = _adapt_tokenizer_for_generation(tokenizer) model_provider.vocab_size = tokenizer.vocab_size model_provider.should_pad_vocab = True @@ -557,6 +536,8 @@ def setup_inference_engine( dist_config=dist_config, ) logger.info("Initialized distributed environment") + if cuda_graphs_enabled and torch.cuda.is_available(): + _seed_cudagraph_safe_rng(rng_config) if use_subquadratic_ops: ensure_subquadratic_ops_supported() @@ -603,57 +584,21 @@ def setup_inference_engine( model = Float16Module(model_provider, raw_model) # ------------------------------------------------------------------------- - # Step 6: Setup MCore inference infrastructure + # Step 6: wire onto the native mcore dynamic-inference engine. # ------------------------------------------------------------------------- - # Create inference wrapper config - model_config = get_model_config(raw_model) - inference_wrapper_config = InferenceWrapperConfig( - hidden_size=model_config.hidden_size, - inference_max_requests=max_batch_size, - inference_max_seq_length=max_seq_length, - inference_batch_times_seqlen_threshold=max_seq_length * max_batch_size, - params_dtype=torch.bfloat16, - padded_vocab_size=tokenizer.vocab_size, - ) - if prompt_segmentation_threshold is not None: - inference_wrapper_config.add_attributes({"prompt_segmentation_threshold": prompt_segmentation_threshold}) - - inference_context: StaticInferenceContext = HyenaInferenceContext( - max_batch_size=max_batch_size, - max_sequence_length=max_seq_length, - ) - inference_context.materialize_only_last_token_logits = False - - # Create the inference wrapper - inference_wrapper = Evo2ModelInferenceWrapper( + # Wire the model onto mcore dynamic inference: paged-KV attention plus Hyena recurrent + # state packed into mcore's two Mamba slots. The per-request lifecycle runs in + # _generate_native_dynamic. flash_decode is already off above. + native_components = _setup_native_dynamic_components( model=model, - inference_wrapper_config=inference_wrapper_config, - inference_context=inference_context, - ) - - # Create the text generation controller and inference engine. - # Evo2 requires the static engine (legacy=True) because the dynamic - # engine's DynamicInferenceContext is incompatible with Hyena SSM state - # management. We use Evo2TextGenerationController which adds prompt - # segmentation threshold (PST) support on top of the static path. - text_generation_controller = Evo2TextGenerationController( - inference_wrapped_model=inference_wrapper, - tokenizer=tokenizer, - ) - - inference_engine = StaticInferenceEngine( - text_generation_controller=text_generation_controller, - max_batch_size=max_batch_size, - random_seed=random_seed, - legacy=True, + raw_model=raw_model, + max_seq_length=max_seq_length, + cuda_graphs_enabled=cuda_graphs_enabled, ) - return Evo2InferenceComponents( - inference_engine=inference_engine, tokenizer=tokenizer, - inference_wrapper=inference_wrapper, - inference_context=inference_context, model=model, + native_dynamic=native_components, ) @@ -666,8 +611,14 @@ def generate( top_k: int = 0, top_p: float = 0.0, return_log_probs: bool = False, + enable_chunked_prefill: bool = False, + inference_dynamic_batching_max_tokens: Optional[int] = None, + inference_dynamic_batching_block_size: int = 256, ) -> List[Any]: - """Generate text using the Evo2 inference engine. + """Generate text using the Evo2 native dynamic-inference engine. + + Drives generation through the native mcore dynamic-inference path (paged-KV attention + + Hyena state packed into mcore's Mamba slots). Args: components: Inference components from setup_inference_engine. @@ -677,34 +628,331 @@ def generate( top_k: Top-k sampling parameter (0 = disabled, 1 = greedy). top_p: Nucleus sampling parameter (0 = disabled). return_log_probs: Whether to return log probabilities. + enable_chunked_prefill: Split prompts across multiple prefill forwards when they exceed + ``inference_dynamic_batching_max_tokens``. Disabled by default. + inference_dynamic_batching_max_tokens: Optional dynamic-context per-step token budget. + When set and chunking is disabled, each prompt must fit within this value. + inference_dynamic_batching_block_size: KV-cache block size for the dynamic context. This is + not the prefill chunk size. Returns: - List of inference result objects (InferenceRequest or - DynamicInferenceRequestRecord depending on the engine backend). + List of :class:`_NativeDynamicResult` objects (mirroring the + ``generated_text`` / ``generated_length`` / ``prompt_tokens`` fields downstream reads). Example: >>> components = setup_inference_engine(ckpt_dir) >>> results = generate(components, ["ATCGATCG"], max_new_tokens=50, top_k=1) >>> print(_unwrap_result(results[0]).generated_text) """ - # Reset inference context before generation - components.inference_context.reset() - - sampling_params = SamplingParams( + return _generate_native_dynamic( + components, + prompts, + max_new_tokens=max_new_tokens, temperature=temperature, - top_k=max(0, top_k), - top_p=top_p if top_p > 0 else 0.0, - num_tokens_to_generate=max_new_tokens, + top_k=top_k, + top_p=top_p, return_log_probs=return_log_probs, + enable_chunked_prefill=enable_chunked_prefill, + inference_dynamic_batching_max_tokens=inference_dynamic_batching_max_tokens, + inference_dynamic_batching_block_size=inference_dynamic_batching_block_size, ) - results = components.inference_engine.generate( - prompts=prompts, - sampling_params=sampling_params, - ) - # Reset context after generation - components.inference_context.reset() +@dataclass +class _NativeDynamicResult: + """Minimal result object mirroring mcore's ``InferenceRequest`` fields used downstream. + + Only the attributes :func:`_result_to_jsonl_record` reads are populated: + ``generated_text``, ``generated_length``, ``prompt_tokens``, ``generated_log_probs``. + """ + + generated_text: str + generated_length: int + prompt_tokens: List[int] + generated_log_probs: Optional[List[float]] = None + + +def _sample_from_logits( + last_token_logits: torch.Tensor, + *, + temperature: float, + top_k: int, + top_p: float, + generator: torch.Generator, + vocab_size: Optional[int] = None, +) -> torch.Tensor: + """Sample next-token ids from logits (greedy / top-k / top-p / temperature). + + Self-contained mcore-compatible sampler for the native dynamic path. Greedy + (``top_k == 1``) returns the argmax; otherwise this applies standard top-k / top-p + filtering followed by ``torch.multinomial`` with the provided RNG. + + Args: + last_token_logits: Logits of shape ``[batch_size, vocab_size]``. + temperature: Temperature scaling factor (applied only on the non-greedy path). + top_k: Top-k filtering value (0 = disabled, 1 = greedy argmax). + top_p: Top-p (nucleus) filtering value (0.0 = disabled). + generator: RNG used by ``torch.multinomial``. + vocab_size: When provided, clamps sampled ids to ``[0, vocab_size - 1]``. + + Returns: + Sampled token ids of shape ``[batch_size]``. + """ + assert isinstance(top_p, float) + assert isinstance(top_k, int) + assert not (top_k > 0 and top_p > 0.0), "Cannot have top-p and top-k both greater than zero" + assert top_p <= 1.0, "top-p should be in (0,1]" + + def _modify_for_top_k(logits, k): + filter_ = logits < torch.topk(logits, k)[0][..., -1, None] + logits.masked_fill_(filter_, float("-Inf")) + + def _modify_for_top_p(logits, p): + sorted_logits, sorted_indices = torch.sort(logits, descending=True) + cumulative_probs = sorted_logits.softmax(dim=-1).cumsum(dim=-1) + filter_ = cumulative_probs > p + # Clone: filter_[:, 1:] and filter_[:, :-1] overlap; without it each write corrupts the read. + filter_[:, 1:] = filter_[:, :-1].clone() + filter_[..., 0] = 0 + filter_ = filter_.scatter(1, sorted_indices, filter_) + logits.masked_fill_(filter_, float("-Inf")) + + if top_k == 1: + return torch.argmax(last_token_logits, dim=-1) + + last_token_logits = last_token_logits.clone() # .div_/.masked_fill_ below are in-place + if temperature != 1.0: + last_token_logits.div_(temperature) + if top_k > 1: + assert top_k <= last_token_logits.size(1), "top-k is larger than logit size." + if vocab_size: + assert top_k < vocab_size, "top-k is larger than vocab size." + _modify_for_top_k(last_token_logits, top_k) + elif top_p > 0.0: + _modify_for_top_p(last_token_logits, top_p) + + probabilities = last_token_logits.softmax(dim=-1) + sampled = torch.multinomial(probabilities, num_samples=1, generator=generator).view(-1) + if vocab_size: + sampled = torch.clamp(sampled, min=0, max=(vocab_size - 1)) + return sampled + + +def _generate_native_dynamic( + components: Evo2InferenceComponents, + prompts: List[str], + *, + max_new_tokens: int, + temperature: float, + top_k: int, + top_p: float, + return_log_probs: bool, + enable_chunked_prefill: bool, + inference_dynamic_batching_max_tokens: Optional[int], + inference_dynamic_batching_block_size: int, +) -> List[_NativeDynamicResult]: + """Drive standalone Evo2 (text→DNA) generation through the native mcore dynamic engine. + + One mcore ``DynamicInferenceContext`` per prompt, driven through the request lifecycle: + ``add_request`` -> :func:`bind_hyena_packed_views_to_dynamic_context` -> + ``initialize_attention_state`` -> model forward -> sample on the LM-head logits -> + ``update_requests``. Standalone Evo2 has its own output layer (``post_process=True``), so + logits are read directly from the forward pass. + + By default, each prompt is prefilled in a single forward pass. When + ``enable_chunked_prefill`` is set, prompts that exceed the dynamic context's ``max_tokens`` + budget are split across multiple prefill forwards, matching mcore's dynamic-inference + scheduling behavior. The KV-cache ``block_size_tokens`` controls paged-KV granularity, not the + prefill chunk length. + """ + # lazy: heavy mcore imports — pull the full dynamic-inference stack only when generating. + from megatron.core.inference.config import InferenceConfig + from megatron.core.inference.contexts.dynamic_context import ( + BlockOverflowError, + MaxSequenceLengthOverflowError, + TokenOverflowError, + ) + from megatron.core.inference.inference_request import DynamicInferenceRequest + + nd = components.native_dynamic + forward_model = nd.forward_model + hyena_model = nd.hyena_model + tokenizer = components.tokenizer + device = next(hyena_model.parameters()).device + rank = int(os.environ.get("RANK", "0")) + + # Greedy unless temperature/top-k/top-p say otherwise. The stock sampler asserts NOT + # (top_k>0 AND top_p>0); honor top-k first for compatibility with SamplingParams. + eff_top_k = max(0, int(top_k)) + eff_top_p = float(top_p) if (top_p and top_p > 0 and eff_top_k == 0) else 0.0 + sampling_rng = torch.Generator(device=device) + sampling_rng.manual_seed(int(getattr(tokenizer, "_evo2_seed", 0)) or 1234) + + results: List[_NativeDynamicResult] = [] + for prompt in prompts: + prompt_token_ids = list(tokenizer.tokenize(prompt)) + n_prompt = len(prompt_token_ids) + # Size the context to cover prompt + generation (+ small headroom). max_requests is kept + # tp-divisible (max(tp,1)); the per-context exact rounder decodes the single request as ONE + # row regardless. buffer_size_gb is auto-sized for the prompt plus generated tokens. + tp = int(getattr(hyena_model.config, "tensor_model_parallel_size", 1) or 1) + max_requests = max(tp, 1) + msl = min(nd.max_seq_length, n_prompt + max_new_tokens + 8) + if msl < n_prompt + 1: + msl = n_prompt + max_new_tokens + 8 + block_size_tokens = int(inference_dynamic_batching_block_size) + if block_size_tokens <= 0: + raise ValueError(f"inference_dynamic_batching_block_size must be positive, got {block_size_tokens}") + max_tokens = inference_dynamic_batching_max_tokens + if max_tokens is not None: + max_tokens = int(max_tokens) + if max_tokens <= 0: + raise ValueError(f"inference_dynamic_batching_max_tokens must be positive, got {max_tokens}") + if n_prompt > max_tokens and not enable_chunked_prefill: + raise ValueError( + f"Prompt has {n_prompt} tokens but inference_dynamic_batching_max_tokens={max_tokens}. " + "Increase --inference-dynamic-batching-max-tokens or pass --enable-chunked-prefill." + ) + buf_gb = compute_evo2_paged_kv_buffer_size_gb( + hyena_model.config, + mamba_state_config=nd.mamba_state_config, + max_sequence_length=msl, + max_requests=max_requests, + block_size_tokens=block_size_tokens, + safety_blocks=2, + ) + dyn_ctx = nd.ctx_cls( + model_config=hyena_model.config, + inference_config=InferenceConfig( + max_sequence_length=msl, + buffer_size_gb=buf_gb, + mamba_inference_state_config=nd.mamba_state_config, + max_requests=max_requests, + max_tokens=max_tokens, + block_size_tokens=block_size_tokens, + unified_memory_level=0, + enable_chunked_prefill=enable_chunked_prefill, + num_cuda_graphs=1 if nd.cuda_graphs_enabled else None, + use_cuda_graphs_for_non_decode_steps=False, + ), + ) + if n_prompt > dyn_ctx.max_tokens and not enable_chunked_prefill: + raise ValueError( + f"Prompt has {n_prompt} tokens but the dynamic context max token budget is {dyn_ctx.max_tokens}. " + "Increase --inference-dynamic-batching-max-tokens or pass --enable-chunked-prefill." + ) + dyn_ctx.materialize_only_last_token_logits = False + dyn_ctx.initialize_all_tensors() + + generated_ids: List[int] = [] + generated_logprobs: List[float] = [] + + def _forward_sample_update(*, count_generated: bool) -> bool: + dyn_ctx.initialize_attention_state() + input_ids, position_ids = dyn_ctx.current_input_and_position_ids() + try: + from megatron.core.inference.utils import InferenceMode + + inference_mode_context = InferenceMode.active() + except ImportError: + inference_mode_context = contextlib.nullcontext() + with inference_mode_context: + logits = forward_model( + input_ids, + position_ids, + None, + inference_context=dyn_ctx, + runtime_gather_output=True, + ) + # HyenaModel returns [B, S, vocab]; last_token_logits expects [1, S, H] and + # selects the per-request final position -> [num_requests, vocab]. Sample in fp32 so + # stochastic filters and logprobs do not depend on the model activation dtype. + last_logits = dyn_ctx.last_token_logits(logits).float() + sampled = _sample_from_logits( + last_logits, + temperature=float(temperature), + top_k=eff_top_k, + top_p=eff_top_p, + generator=sampling_rng, + vocab_size=tokenizer.vocab_size, + ) + if count_generated: + next_tok_id = int(sampled[0].item()) + generated_ids.append(next_tok_id) + if return_log_probs: + logprob = torch.log_softmax(last_logits[0].float(), dim=-1)[next_tok_id].item() + generated_logprobs.append(logprob) + active_after_sample = torch.tensor( + [not count_generated or len(generated_ids) < max_new_tokens], dtype=torch.bool, device=device + ) + dyn_ctx.update_requests(active_after_sample, sampled.to(dtype=torch.int64, device=device)) + return bool(active_after_sample[0].item()) + + try: + with torch.inference_mode(): + req = DynamicInferenceRequest( + request_id=0, + prompt_tokens=torch.tensor(prompt_token_ids, dtype=torch.int64, device=device), + sampling_params=SamplingParams(num_tokens_to_generate=max_new_tokens, termination_id=-1), + ) + if max_new_tokens > 0: + first_chunk = True + while req.remaining_prompt_length > 0: + chunk_len = req.remaining_prompt_length + is_partial_chunk = False + if enable_chunked_prefill and req.remaining_prompt_length > dyn_ctx.max_tokens: + chunk_len = dyn_ctx.max_tokens + final_chunk_len = req.remaining_prompt_length - chunk_len + if final_chunk_len == 1: + if chunk_len <= 1: + raise ValueError( + "Chunked prefill cannot split this prompt without leaving a one-token " + "final prefill chunk. Increase --inference-dynamic-batching-max-tokens." + ) + chunk_len -= 1 + is_partial_chunk = True + dyn_ctx.chunked_prefill_request_id = req.request_id if is_partial_chunk else -1 + dyn_ctx.add_request(req, prefill_chunk_length=chunk_len) + if first_chunk: + slot = int(dyn_ctx.mamba_metadata.request_to_mamba_state_idx[0].item()) + bind_hyena_packed_views_to_dynamic_context(hyena_model, dyn_ctx, request_slot=slot) + first_chunk = False + if rank == 0: + logger.info( + "[evo2-native] prompt prefill: chunk=%d/%d tokens, remaining=%d", + chunk_len, + n_prompt, + req.remaining_prompt_length - chunk_len, + ) + _forward_sample_update(count_generated=not is_partial_chunk) + if not is_partial_chunk: + req.remaining_prompt_tokens = req.remaining_prompt_tokens.new_empty(0) + break + req.remaining_prompt_tokens = req.remaining_prompt_tokens[chunk_len:] + req.finished_chunk_token_count += chunk_len + + while len(generated_ids) < max_new_tokens and dyn_ctx.has_unfinished_requests(): + _forward_sample_update(count_generated=True) + except (BlockOverflowError, TokenOverflowError, MaxSequenceLengthOverflowError) as exc: + if rank == 0: + logger.warning( + "[evo2-native] generation stopped early at %d tokens (context overflow: %s). " + "Increase --max-seq-length to cover prompt + max_new_tokens.", + len(generated_ids), + type(exc).__name__, + ) + finally: + dyn_ctx.reset() + + generated_text = tokenizer.detokenize(generated_ids) if generated_ids else "" + results.append( + _NativeDynamicResult( + generated_text=generated_text, + generated_length=len(generated_ids), + prompt_tokens=prompt_token_ids, + generated_log_probs=generated_logprobs if return_log_probs else None, + ) + ) return results @@ -900,16 +1148,6 @@ def parse_args() -> argparse.Namespace: "proportional to this value (KV caches, attention masks, internal buffers). " "For large models (e.g. 40b), only batch_size=1 may fit in memory.", ) - ap.add_argument( - "--prompt-segmentation-threshold", - type=int, - default=None, - help="If set, prompts longer than this many tokens are segmented during prefill " - "to reduce peak GPU memory. The first segment runs as a normal prefill pass; " - "remaining prompt tokens are processed one at a time (at decode speed) before " - "generation begins. Useful for long prompts that would otherwise OOM. " - "Also settable via EVO2_PST env var.", - ) ap.add_argument( "--use-subquadratic-ops", action="store_true", @@ -918,6 +1156,25 @@ def parse_args() -> argparse.Namespace: "fft_causal_conv1d / causal_conv1d in parallel_fir). Speeds up prompt processing " "but has no effect on per-token decode throughput.", ) + ap.add_argument( + "--enable-chunked-prefill", + action="store_true", + default=False, + help="Enable mcore-style chunked prefill when prompts exceed the dynamic context max-token budget.", + ) + ap.add_argument( + "--inference-dynamic-batching-max-tokens", + type=int, + default=None, + help="Dynamic context per-step token budget. When set and --enable-chunked-prefill is not " + "passed, each prompt must fit within this many tokens.", + ) + ap.add_argument( + "--inference-dynamic-batching-block-size", + type=int, + default=256, + help="Paged-KV block size for dynamic inference. This is not the prefill chunk length.", + ) return ap.parse_args() @@ -940,8 +1197,11 @@ def infer( vortex_style_fp8: bool = False, max_seq_length: int = 8192, max_batch_size: int = 1, - prompt_segmentation_threshold: Optional[int] = None, use_subquadratic_ops: bool = False, + enable_chunked_prefill: bool = False, + inference_dynamic_batching_max_tokens: Optional[int] = None, + inference_dynamic_batching_block_size: int = 256, + force_exit_on_completion: bool = False, ) -> List[Dict[str, Any]]: """Run autoregressive text generation with Evo2 using MCore inference. @@ -967,9 +1227,12 @@ def infer( max_seq_length: Maximum sequence length. max_batch_size: Maximum batch size for inference. The inference engine pre-allocates GPU memory proportional to this value. For large models, only 1 may fit. - prompt_segmentation_threshold: If set, prompts longer than this are segmented - during prefill to reduce peak memory. use_subquadratic_ops: Use fused subquadratic-ops kernels in the inference path. + enable_chunked_prefill: Split prompts across multiple prefill forwards when needed. + inference_dynamic_batching_max_tokens: Optional dynamic-context per-step token budget. + inference_dynamic_batching_block_size: Paged-KV block size for dynamic inference. + force_exit_on_completion: For CLI use, immediately exit after successful CUDA-graph + inference to avoid torchrun/NCCL atexit hangs with captured collectives. Returns: List of JSONL-serialisable result dicts. @@ -989,9 +1252,11 @@ def infer( mixed_precision_recipe=mixed_precision_recipe, vortex_style_fp8=vortex_style_fp8, random_seed=random_seed, - prompt_segmentation_threshold=prompt_segmentation_threshold, use_subquadratic_ops=use_subquadratic_ops, ) + # Thread the resolved seed into the native sampler RNG (read off the tokenizer handle in + # _generate_native_dynamic). + components.tokenizer._evo2_seed = random_seed mem_after_setup_gb = torch.cuda.max_memory_allocated() / (1024**3) logger.info(f"[MEMORY] After model setup: peak={mem_after_setup_gb:.3f} GB") @@ -1017,6 +1282,9 @@ def infer( top_k=top_k, top_p=top_p, return_log_probs=return_log_probs, + enable_chunked_prefill=enable_chunked_prefill, + inference_dynamic_batching_max_tokens=inference_dynamic_batching_max_tokens, + inference_dynamic_batching_block_size=inference_dynamic_batching_block_size, ) t_batch_elapsed = time.perf_counter() - t_batch_start @@ -1073,9 +1341,12 @@ def infer( logger.info("Inference complete!") - if dist.is_initialized(): - dist.barrier() - dist.destroy_process_group() + if force_exit_on_completion and components.native_dynamic.cuda_graphs_enabled: + # Megatron's CUDA graph inference examples force-exit here as well: captured + # collectives can otherwise leave torchrun waiting in NCCL atexit teardown. + _force_exit_after_cuda_graph_inference() + + _teardown_distributed_for_inference() return all_records @@ -1091,7 +1362,6 @@ def main() -> None: # --- Resolve settings: CLI arg > env var > auto-detected default --- max_seq_length = _resolve_int(args.max_seq_length, "EVO2_MAX_SEQ_LEN", _detect_max_seq_length(args.ckpt_dir)) - prompt_segmentation_threshold = _resolve_int(args.prompt_segmentation_threshold, "EVO2_PST", None) if args.prompt_file is not None: prompts = _read_prompts_jsonl(args.prompt_file) @@ -1115,8 +1385,11 @@ def main() -> None: vortex_style_fp8=args.vortex_style_fp8, max_seq_length=max_seq_length, max_batch_size=args.max_batch_size, - prompt_segmentation_threshold=prompt_segmentation_threshold, use_subquadratic_ops=args.use_subquadratic_ops, + enable_chunked_prefill=args.enable_chunked_prefill, + inference_dynamic_batching_max_tokens=args.inference_dynamic_batching_max_tokens, + inference_dynamic_batching_block_size=args.inference_dynamic_batching_block_size, + force_exit_on_completion=True, ) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer_example_simple.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer_example_simple.py index 187daf1306..3a9f238861 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer_example_simple.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer_example_simple.py @@ -19,11 +19,11 @@ """Simple autoregressive generation example for Evo2 models. This module provides a straightforward implementation of autoregressive text generation -that directly calls the model forward pass without using the full MCore inference +that directly calls the model forward pass without using the native dynamic-inference infrastructure. This is useful for: 1. Understanding how autoregressive generation works at a low level -2. Debugging and testing model behavior +2. Debugging and testing direct model-forward behavior 3. Custom generation workflows that don't fit the MCore API For production use, prefer the MCore-based inference in `bionemo.evo2.run.infer`. @@ -63,7 +63,7 @@ def generate_tokens_simple( Unlike the MCore-based inference in `bionemo.evo2.run.infer`, this function: - Directly calls model.forward() instead of using inference wrappers - Manually manages sequence_len_offset and decode_mode - - Does not use TextGenerationController or StaticInferenceEngine + - Does not use the native dynamic-inference request lifecycle Args: model: The Evo2 model (typically Float16Module wrapped). @@ -92,8 +92,8 @@ def generate_tokens_simple( >>> print(tokens) # [65, 84, 67, 71, ...] (continues the pattern) Note: - For production use, prefer `bionemo.evo2.run.infer.generate()` which uses - the MCore inference infrastructure with proper batching, sampling, and + For production use, prefer `bionemo.evo2.run.infer.generate()` which uses the + native MCore dynamic-inference path with proper sampling, request lifecycle, and distributed support. """ device = prompt_tokens.device diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/text_generation_controller.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/text_generation_controller.py deleted file mode 100644 index c795c16575..0000000000 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/text_generation_controller.py +++ /dev/null @@ -1,555 +0,0 @@ -# SPDX-FileCopyrightText: Copyright (c) 2026 NVIDIA CORPORATION & AFFILIATES. All rights reserved. -# SPDX-License-Identifier: LicenseRef-Apache2 -# -# Licensed under the Apache License, Version 2.0 (the "License"); -# you may not use this file except in compliance with the License. -# You may obtain a copy of the License at -# -# http://www.apache.org/licenses/LICENSE-2.0 -# -# Unless required by applicable law or agreed to in writing, software -# distributed under the License is distributed on an "AS IS" BASIS, -# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. -# See the License for the specific language governing permissions and -# limitations under the License. - -"""Evo2TextGenerationController — adds prompt segmentation threshold (PST) support. - -Stock megatron-core (0.16.0rc0) ``TextGenerationController`` hard-codes the initial -``context_end_position`` for prefill to ``min_prompt_length_in_batch``. This means -the entire prompt is processed in one forward pass, which can OOM on long prompts. - -This subclass overrides ``generate_all_output_tokens_static_batch`` to read an -optional ``prompt_segmentation_threshold`` attribute from the -``InferenceWrapperConfig``. When set, the first prefill covers only ``pst`` tokens -and the remaining prompt tokens are processed one-at-a-time (decode speed) before -normal generation begins. - -The override is a verbatim copy of the megatron-core 0.16.0rc0 method (commit -``bbbedbb9f53``, installed via Megatron-Bridge ``549e3cb``) with only the -``context_end_position`` initialisation changed (marked ``# --- PST ---``). - -The method body is wrapped in ``# fmt: off`` and lint suppressions to keep it as -close to the upstream source as possible, simplifying future diffs when upgrading -megatron-core. -""" - -# ruff: noqa: N812, C417, RUF015, F841, D417 - -import concurrent.futures -import copy -import functools -from collections import defaultdict -from typing import Any, Dict, List, Optional, OrderedDict - -import torch -import torch.nn.functional as F -from megatron.core.inference.async_stream import AsyncStream -from megatron.core.inference.communication_utils import ( - broadcast_from_last_pipeline_stage, - is_pipeline_last_stage, -) -from megatron.core.inference.contexts.dynamic_context import MaxSequenceLengthOverflowError -from megatron.core.inference.inference_request import InferenceRequest, Status -from megatron.core.inference.sampling_params import SamplingParams -from megatron.core.inference.text_generation_controllers.text_generation_controller import ( - TextGenerationController, -) -from megatron.core.inference.utils import set_decode_expert_padding -from megatron.core.transformer.enums import CudaGraphScope -from megatron.core.transformer.moe.moe_layer import BaseMoELayer -from megatron.core.transformer.utils import set_model_to_sequence_parallel -from megatron.core.utils import get_model_config, unwrap_model - - -class Evo2TextGenerationController(TextGenerationController): - """TextGenerationController with prompt segmentation threshold (PST) support. - - When ``prompt_segmentation_threshold`` is set on the ``InferenceWrapperConfig`` - (via ``config.add_attributes(...)``), prompts longer than the threshold are - segmented during prefill to reduce peak activation memory. - """ - - # ------------------------------------------------------------------ - # Verbatim copy of megatron-core 0.16.0rc0 - # ``TextGenerationController.generate_all_output_tokens_static_batch`` - # with a single change at the ``# --- PST ---`` marker. - # ------------------------------------------------------------------ - # fmt: off - @torch.inference_mode() - def generate_all_output_tokens_static_batch( - self, - active_requests: OrderedDict[int, InferenceRequest], - active_streams: Optional[OrderedDict[str, AsyncStream]] = None, - ) -> OrderedDict[int, InferenceRequest]: - """Utility to generate all the output tokens and probabilities for the prompts. - - This utility generates the output tokens for a static batch. It runs the forward steps till - all prompts complete generation, updates the status of these requests to completed, adds - the generated result and returns these requests - - Args: - active_requests (OrderedDict[int, InferenceRequest]): The input active requests. - - Returns: - OrderedDict[int, InferenceRequest]: The result for each of the incoming requests - """ - assert all(request.prompt_tokens is not None for request in active_requests.values()) - - # Perform a deep copy so that the request prompt tokens do not get modified. - batch_prompt_tokens_list: List[List[int]] = list( - map( - lambda request: copy.deepcopy(request.prompt_tokens), # type: ignore[arg-type] - active_requests.values(), - ) - ) - prompt_lengths_in_batch = torch.tensor( - [len(prompt_tokens) for prompt_tokens in batch_prompt_tokens_list], - device=torch.cuda.current_device(), - ) - max_prompt_length_in_batch = max(prompt_lengths_in_batch) - min_prompt_length_in_batch = min(prompt_lengths_in_batch) - - # For batch inference the sampling params are the same for all request - sampling_params: SamplingParams = list(active_requests.values())[0].sampling_params - - # Remove Float16Module wrapper if it exists - unwrapped_model = unwrap_model(self.inference_wrapped_model.model) - model_config = get_model_config(unwrapped_model) - - # We only need an attention mask if we are exclusively doing prefill over - # prompts of variable length - use_attention_mask = ( - sampling_params.num_tokens_to_generate == 0 - and min_prompt_length_in_batch != max_prompt_length_in_batch - ) - - # Check whether CUDA graphs are enabled - enable_cuda_graph = ( - model_config.cuda_graph_impl == "local" - and CudaGraphScope.full_iteration not in model_config.cuda_graph_scope - ) - - # Pad batch tokens if necessary - batch_size = len(active_requests) - max_sequence_length = max_prompt_length_in_batch + sampling_params.num_tokens_to_generate - inference_wrapper_config = self.inference_wrapped_model.inference_wrapper_config - inference_max_batch_size = inference_wrapper_config.inference_max_requests - inference_max_sequence_length = inference_wrapper_config.inference_max_seq_length - padded_batch_size = inference_max_batch_size if enable_cuda_graph else batch_size - if padded_batch_size > inference_max_batch_size: - raise ValueError( - f"Padded batch size {padded_batch_size} > max batch size {inference_max_batch_size}" - ) - padded_batch_prompt_tokens = self.pad_input_prompt_tokens( - batch_prompt_tokens_list, - padded_batch_size=padded_batch_size, - padded_sequence_length=max_sequence_length, - ) - - # Verify that output sequence length is within configured limit - if max_sequence_length > inference_max_sequence_length: - raise MaxSequenceLengthOverflowError( - f"Maximum allowed sequence length was set to {inference_max_sequence_length} " - f"tokens but requested generation of {max_sequence_length} tokens" - ) - - top_n_logprobs_dict = defaultdict(list) - - # Pre allocate log probs tensor - output_log_probs = None - if sampling_params.return_log_probs: - output_log_probs = torch.empty( - (batch_size, max_sequence_length - 1), - dtype=torch.float32, - device=torch.cuda.current_device(), - ) - - # An array to check which of the prompts have reached end of generation condition - is_generation_done_tensor = torch.zeros( - batch_size, dtype=torch.bool, device=torch.cuda.current_device() - ) - - # An array to act as a counter to keep track of generated sequence lengths - generated_sequence_lengths = torch.zeros( - batch_size, device=torch.cuda.current_device() - ).cuda() - - # Use padded vocab size because tokenizer vocab size might not include padding - # to nearest power of 2 - vocab_size = inference_wrapper_config.padded_vocab_size - - # Check whether early termination is enabled - no_early_termination = getattr(sampling_params, "no_early_termination", False) - termination_id = -1 if no_early_termination else self.tokenizer.eod - - streaming_enabled = active_streams is not None and len(active_streams) > 0 - if streaming_enabled: - # Start a separate thread for streaming tokens to avoid blocking the - # main computation - streaming_idx: List[int] = [ - i - for (i, request_id) in enumerate(active_requests.keys()) - if request_id in active_streams - ] - streaming_request_ids: List[int] = list(active_streams.keys()) - streams: List[AsyncStream] = list(active_streams.values()) - streaming_requests: List[InferenceRequest] = [ - active_requests[request_id] for request_id in streaming_request_ids - ] - streaming_executor = concurrent.futures.ThreadPoolExecutor(max_workers=1) - stream_tokens = functools.partial(self.stream_tokens, sampling_params) - - for request in active_requests.values(): - # Initialize to a list to store a latency measurement for each generated token. - request.tpot = [] - timing_events = [] - - with torch.inference_mode(): - self.inference_wrapped_model.prep_model_for_inference() - - inference_input: Dict[str, Any] = self.prep_inference_input( - prompts_tokens=padded_batch_prompt_tokens, - active_requests=active_requests, - use_attention_mask=use_attention_mask, - ) - - assert ( - not self.inference_wrapped_model.inference_context.is_decode_only() - ), "Generation must start in prefill mode" - - # Sequence parallelism is required for MoE layers when using expert parallelism (EP) - # becausethe expert routing mechanism relies on sequence parallelism's communication - # infrastructure to distribute tokens across expert ranks. However, sequence parallelism - # is not currently supported for non-MoE layers during inference, so we selectively - # disable it for all other layer types. This is safe because MoE layers perform an - # all-gather operation on sequences before passing data to subsequent layers, ensuring - # that each rank has the complete sequence data needed for the next non-MoE layer. - tp_size = model_config.tensor_model_parallel_size - ep_size = model_config.expert_model_parallel_size - model_is_tp_ep = tp_size > 1 and ep_size > 1 - if model_is_tp_ep: - set_model_to_sequence_parallel( - unwrapped_model, False, exclude_modules=[BaseMoELayer] - ) - elif model_config.sequence_parallel and (ep_size == 1 or tp_size == 1): - raise NotImplementedError( - "Sequence parallellism is only supported for static batching with MoE models" - ) - - # If using symmetric kernels and we are using using nccl - # for prefill turn off symmetric kernels - symmetric_ar_type = model_config.symmetric_ar_type - nccl_all_reduce_for_prefill = inference_wrapper_config.nccl_all_reduce_for_prefill - if symmetric_ar_type is not None and nccl_all_reduce_for_prefill: - unwrapped_model.set_symmetric_ar(None) - - # Turning off MoE padding for prefill - moe_pad_experts_for_cuda_graph_inference = ( - inference_wrapper_config.moe_pad_experts_for_cuda_graph_inference - ) - if moe_pad_experts_for_cuda_graph_inference: - set_decode_expert_padding(unwrapped_model, False) - - context_start_position = 0 - - # If we are exclusively doing prefill then we can process all prompt tokens - # together even if the prompt lengths are different - if sampling_params.num_tokens_to_generate == 0: - context_end_position = max_prompt_length_in_batch - else: - # --- PST --- - # Stock megatron-core uses: context_end_position = min_prompt_length_in_batch - # With PST, we cap the initial prefill to reduce peak activation memory. - pst = getattr(inference_wrapper_config, 'prompt_segmentation_threshold', None) - pst = min(pst or min_prompt_length_in_batch, min_prompt_length_in_batch) - context_end_position = pst - # --- end PST --- - - # The initial iteration of this loop runs the prefill phase up to the shortest - # prompt length in the batch. Then every subsequent iterations runs a decode step. - # At least one new token will be generated in each iteration. The generated token - # will be ignored for requests which have prompt length > the current generated - # sequence length. Similarly, the generated token is ignored for requests which - # have maximum total sequence length < the current generated sequence length. - while True: - # Add a timing event at the start of each iteration. The token generation - # time will be the elapsed time between consective timing events. - timing_events.append(torch.cuda.Event(enable_timing=True)) - timing_events[-1].record() - - # Pick the context window that we need to pass through the network. - inference_input_for_context_window: Dict[str, Any] = ( - self.inference_wrapped_model.get_batch_for_context_window( - inference_input, context_start_position, context_end_position - ) - ) - - # Disable attention mask when using CUDA graphs for decode - if ( - enable_cuda_graph - and self.inference_wrapped_model.inference_context.is_decode_only() - and "attention_mask" in inference_input_for_context_window - ): - inference_input_for_context_window["attention_mask"] = None - elif use_attention_mask: - assert ( - attention_mask := inference_input_for_context_window.get( - "attention_mask", None - ) - is not None - ) - - # Only materialize prompt log probs if the user requests log probs - materialize_only_last_token_logits = ( - self.inference_wrapped_model.inference_context.is_decode_only() - or not (sampling_params.return_log_probs or sampling_params.top_n_logprobs > 0) - ) - inference_context = self.inference_wrapped_model.inference_context - inference_context.materialize_only_last_token_logits = ( - materialize_only_last_token_logits - ) - - # Returns the final logits of shape [batch_size, context_length, vocab_size] - # Note: This is returned in all TP ranks or last PP stage in PP models - logits = self.inference_wrapped_model.run_one_forward_step( - inference_input_for_context_window - ) - - # Undo padding if necessary - batch_prompt_tokens = self.unpad_input_prompt_tokens( - padded_batch_prompt_tokens, batch_size - ) - assert batch_prompt_tokens.shape[0] == batch_size, batch_prompt_tokens.shape[0] - if is_pipeline_last_stage(self.pp_group): - logits = logits[:batch_size] - - if self.model_is_pipeline_parallel: - context_length = context_end_position - context_start_position - logits_seq_len = 1 if materialize_only_last_token_logits else context_length - logits_shape = [batch_size, logits_seq_len, vocab_size] - if is_pipeline_last_stage(self.pp_group): - assert logits is not None and torch.Size(logits_shape) == logits.shape - # TODO(ksanthanam): Evaluate whether it makes more sense to sample on 1 rank - # and then broadcast the sampled tokens rather than broadcasting the raw logits. - logits = broadcast_from_last_pipeline_stage( - [batch_size, logits_seq_len, vocab_size], - dtype=inference_wrapper_config.params_dtype, - tensor=logits, - pp_group=self.pp_group, - ) - - # Turn on symmetric all reduce kernels for decode stage - # if we turned it off for prefill - if ( - context_end_position == min_prompt_length_in_batch - and symmetric_ar_type is not None - and nccl_all_reduce_for_prefill - ): - if symmetric_ar_type is not None and nccl_all_reduce_for_prefill: - unwrapped_model.set_symmetric_ar(symmetric_ar_type) - - # Indicates which of the input prompts have started generating tokens. - # A 1D boolean tensor with [batch_size] elements (i.e) The shortest - # prompts will start generating first and so on - generation_started = prompt_lengths_in_batch <= context_end_position - last_token_logits = logits[:, -1, :] - - logits_for_top_n_prompt_logprobs = ( - logits - if context_start_position == 0 and not sampling_params.skip_prompt_log_probs - else None - ) - sampled_logits = self.sample_from_logits( - last_token_logits, - sampling_params, - vocab_size, - generation_started=generation_started, - top_n_logprobs_dict=top_n_logprobs_dict, - logits=logits_for_top_n_prompt_logprobs, - ) - - if sampling_params.num_tokens_to_generate > 0: - # Substitute the sampled logits only for the prompts that - # have started generating tokens - batch_prompt_tokens[generation_started, context_end_position] = sampled_logits[ - generation_started - ] - - # Compute log probs - if sampling_params.return_log_probs: - log_probs = F.log_softmax(logits, dim=2).to(torch.float32) - - indices = torch.unsqueeze( - batch_prompt_tokens[ - :, (context_start_position + 1) : (context_end_position + 1) - ], - 2, - ) - # Get the log probabilities for only the prompt tokens - assert output_log_probs is not None - output_log_probs[:, context_start_position:context_end_position] = torch.gather( - log_probs, 2, indices - ).squeeze(2) - - context_start_position = context_end_position - - if sampling_params.num_tokens_to_generate > 0: - # Check end of generation status for each tensor - # and update generated sequence lengths - (is_generation_done_tensor, generated_sequence_lengths) = ( - self.update_generation_status( - updated_prompts_tokens=batch_prompt_tokens, - generation_started=generation_started, - current_context_end_position=context_end_position, - is_generation_done_tensor=is_generation_done_tensor, - generated_sequence_lengths=generated_sequence_lengths, - termination_id=termination_id, - ) - ) - - # Stream intermediate outputs - if streaming_enabled: - streaming_executor.submit( - stream_tokens, - streaming_request_ids, - streaming_requests, - streams, - generation_started[streaming_idx].cpu(), - is_generation_done_tensor[streaming_idx].cpu(), - batch_prompt_tokens[streaming_idx].cpu(), - prompt_lengths_in_batch[streaming_idx].cpu(), - generated_sequence_lengths[streaming_idx].cpu(), - ( - output_log_probs[streaming_idx].cpu() - if output_log_probs is not None - else [None] * len(streaming_idx) - ), - ) - - # Boolean flag indicating if all prompts are finished - all_prompts_done = torch.all(is_generation_done_tensor) - if all_prompts_done: - break - - # Change to decode mode if all prefill is complete - if torch.all(generation_started): - self.inference_wrapped_model.inference_context.enable_decode_mode() - # Turn on padding for decode if flag set - if moe_pad_experts_for_cuda_graph_inference: - capacity_factor = ( - model_config.num_moe_experts / model_config.moe_router_topk - ) - set_decode_expert_padding( - unwrapped_model, True, capacity_factor=capacity_factor - ) - - context_end_position = context_start_position + 1 - if context_end_position >= max_sequence_length: - break - - # Add a final timing event to compute the latency of every loop iteration - timing_events.append(torch.cuda.Event(enable_timing=True)) - timing_events[-1].record() - - # Close all streams - if streaming_enabled: - streaming_executor.shutdown() - for stream in streams: - stream.finish() - - # Include all the generated tokens - batch_prompt_tokens_with_generations = padded_batch_prompt_tokens[ - :batch_size, : (context_end_position + 1) - ] - if sampling_params.return_log_probs: - assert output_log_probs is not None - output_log_probs = output_log_probs[:, :context_end_position] - - generated_sequence_lengths[ - generated_sequence_lengths > sampling_params.num_tokens_to_generate - ] = sampling_params.num_tokens_to_generate - - timing_events[-1].synchronize() - tpot = torch.tensor( - [ - timing_events[i].elapsed_time(timing_events[i + 1]) / 1e3 - for i in range(len(timing_events) - 1) - ], - dtype=torch.float32, - ) - - for idx, request in enumerate(active_requests.values()): - input_prompt_length = int(prompt_lengths_in_batch[idx]) - # Shorter prompts might have generated more than required tokens. So we trim them down - required_sequence_length = int( - min(generated_sequence_lengths[idx], sampling_params.num_tokens_to_generate) - ) - # Extract only the generated tokens - required_result_tokens = batch_prompt_tokens_with_generations[ - idx, input_prompt_length : (input_prompt_length + required_sequence_length) - ] - request.generated_sequence_lengths = generated_sequence_lengths[idx].to(dtype=torch.int32) - request.generated_length = required_sequence_length - request.generated_tokens = required_result_tokens - - # Record the decode latencies for only the generated tokens - request_tpot = tpot.clone() - # Sum up the latencies of the first prompt tokens if the - # request prompt length > minimum prompt length - spill_length = input_prompt_length - min_prompt_length_in_batch - if spill_length > 0: - spill_latency = request_tpot[:spill_length].sum() - request_tpot = torch.cat((spill_latency.unsqueeze(0), request_tpot[spill_length:])) - - # Remove the extraneous latencies if the - # request sequence length < maximum sequence length - request_tpot = request_tpot[:required_sequence_length] - request.tpot = request_tpot.tolist() - - if output_log_probs is not None: - request.prompt_log_probs = output_log_probs[idx, : input_prompt_length - 1].tolist() - request.generated_log_probs = output_log_probs[ - idx, - input_prompt_length - 1 : (input_prompt_length + required_sequence_length - 1), - ].tolist() - if sampling_params.top_n_logprobs > 0: - if not sampling_params.skip_prompt_log_probs: - assert ( - len(top_n_logprobs_dict[idx]) - >= input_prompt_length + required_sequence_length - 1 - ), ( - "Did not collect required number of top-N logprobs: " - f"{len(top_n_logprobs_dict[idx])}" - ) - request.prompt_top_n_logprobs = top_n_logprobs_dict[idx][ - : input_prompt_length - 1 - ] - request.generated_top_n_logprobs = top_n_logprobs_dict[idx][ - input_prompt_length - - 1 : (input_prompt_length + required_sequence_length - 1) - ] - else: - assert len(top_n_logprobs_dict[idx]) >= required_sequence_length, ( - "Did not collect required number of top-N logprobs: " - f"{len(top_n_logprobs_dict[idx])}" - ) - request.generated_top_n_logprobs = top_n_logprobs_dict[idx][ - :required_sequence_length - ] - - request.status = Status.COMPLETED - - text, segments = self.detokenize_generations( - batch_prompt_tokens_with_generations[ - idx, : (input_prompt_length + required_sequence_length) - ], - input_prompt_length + generated_sequence_lengths[idx], - sampling_params.return_segments, - ) - request.text = text # Inference server returns prompts & generations together - if sampling_params.return_segments: - request.segments = segments[0] - request.generated_text = text[len(request.prompt) :] - return active_requests - # fmt: on diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py index 618a0f6f20..d11682b0b3 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py @@ -18,9 +18,17 @@ """Tests for Evo2 text generation (inference) using MBridge. -NOTE: Autoregressive generation tests may fail due to: -1. FP8 execution requires sequence dimensions divisible by 8/16 -2. The vortex flash_decode path needs additional integration work +infer.py drives generation through the NATIVE mcore dynamic-inference engine (paged-KV attention + +Hyena recurrent state packed into mcore's two Mamba slots), which is the only engine here. +The general generation tests below +(test_infer_runs, test_infer_temperature, test_infer_top_k, test_infer_phylogenetic_prompt, +test_identical_prompts_should_be_identical, test_subquadratic_ops_matches_baseline, +test_different_prompts_produce_different_outputs, test_different_results_with_without_peft, +the batch-padding prefix-invariance test, and the parallel-accuracy tests) all exercise this +engine; they assert "infer.py generates valid DNA" rather than any engine-specific internal. +The native dynamic tests add edge-case coverage (full-prompt multi-block prefill, opt-in +chunked prefill, single-token decode, longer generation, short-prompt right-aligned seed, TP=2 +batch=1). The core forward pass (predict.py) and HyenaInferenceContext are tested in test_evo2.py which has working test_forward_manual and test_forward_ckpt_conversion. @@ -290,9 +298,15 @@ def run_infer_subprocess( top_k: int = 1, seed: int = 42, use_subquadratic_ops: bool = False, + max_seq_length: int | None = None, + return_log_probs: bool = False, + extra_args: list[str] | None = None, ): """Helper function to run inference as a subprocess. + Generation runs through the native mcore dynamic-inference engine (the only engine: paged-KV + attention + Hyena state in mcore Mamba slots). + Args: mbridge_checkpoint_path: Path to the MBridge checkpoint prompt: Input prompt for the model @@ -302,9 +316,12 @@ def run_infer_subprocess( top_k: Top-k sampling parameter (1 for greedy) seed: Random seed for reproducibility use_subquadratic_ops: Pass --use-subquadratic-ops to the CLI. + max_seq_length: If set, pass --max-seq-length (caps the per-context allocation). + return_log_probs: Pass --return-log-probs (logprobs included in the JSONL record). + extra_args: Additional CLI arguments appended to the infer command. Returns: - The generated completion text from the first JSONL record + The single JSONL result record (dict) for the prompt. """ open_port = find_free_network_port() @@ -335,6 +352,12 @@ def run_infer_subprocess( ] if use_subquadratic_ops: cmd.append("--use-subquadratic-ops") + if max_seq_length is not None: + cmd.extend(["--max-seq-length", str(max_seq_length)]) + if return_log_probs: + cmd.append("--return-log-probs") + if extra_args: + cmd.extend(extra_args) env = copy.deepcopy(PRETEST_ENV) @@ -353,7 +376,7 @@ def run_infer_subprocess( records = _read_jsonl_results(output_file) assert len(records) == 1, f"Expected 1 JSONL record, got {len(records)}" - return records[0]["completion"] + return records[0] def mid_point_split(*, seq, num_tokens: int | None = None, fraction: float = 0.5): @@ -476,7 +499,13 @@ def test_infer_evo2_short_prefill_is_prefix_invariant_across_batch_padding( tmp_path, infer_use_subquadratic_ops: bool, ): - """A short prefill should generate the same next token alone or in a padded batch.""" + """A short prefill should generate the same next token alone or in a padded batch. + + Routes through the native default engine. Native decodes each prompt as its own single-request + context (no static batch padding), so the short prompt's completion + logprob must match whether + it is submitted alone or alongside a longer prompt — the same "infer.py generates valid, + batch-independent DNA" invariant, now exercised on the working path. + """ if torch.cuda.device_count() < 1: pytest.skip("Inference prefill prefix-invariance test requires a GPU") @@ -527,7 +556,6 @@ def run_infer_subprocess_parallel( tensor_parallel_size: int = 1, pipeline_model_parallel_size: int = 1, context_parallel_size: int = 1, - prompt_segmentation_threshold: int | None = None, ) -> list[dict]: """Run inference as a subprocess with model parallelism. @@ -546,7 +574,6 @@ def run_infer_subprocess_parallel( tensor_parallel_size: Tensor parallelism degree. pipeline_model_parallel_size: Pipeline parallelism degree. context_parallel_size: Context parallelism degree. - prompt_segmentation_threshold: If set, prompts longer than this are segmented. Returns: List of parsed JSONL result dicts. @@ -584,8 +611,6 @@ def run_infer_subprocess_parallel( "--context-parallel-size", str(context_parallel_size), ] - if prompt_segmentation_threshold is not None: - cmd.extend(["--prompt-segmentation-threshold", str(prompt_segmentation_threshold)]) env = copy.deepcopy(PRETEST_ENV) # Prepend the source src/ directory to PYTHONPATH so that local model code @@ -818,64 +843,6 @@ def test_parallel_inference_accuracy(mbridge_checkpoint_path, tmp_path, dna_sequ ) -@pytest.mark.slow -@pytest.mark.timeout(900) -@pytest.mark.skipif(bool(os.environ.get("CI")), reason="Skip in CI") -def test_parallel_inference_accuracy_with_pst(mbridge_checkpoint_path, tmp_path, dna_sequences): - """Test that prompt segmentation does not degrade generation accuracy. - - Runs the same accuracy check as test_parallel_inference_accuracy but with - --prompt-segmentation-threshold set low enough to be triggered by the test - prompts (~3400 tokens each). The generated output must match the same - accuracy thresholds as the non-PST baseline, proving that prompt - segmentation is numerically equivalent. - """ - num_tokens = 500 - expected_matchpercents = [96.8, 29.7, 76.6, 71.6] - - targets_by_id: dict[str, str] = {} - expected_by_id: dict[str, float] = {} - jsonl_entries = [] - for i, (seq, expected_mp) in enumerate(zip(dna_sequences, expected_matchpercents)): - prompt, target = mid_point_split(seq=seq, num_tokens=num_tokens, fraction=0.5) - seq_id = f"seq_{i}" - targets_by_id[seq_id] = target - expected_by_id[seq_id] = expected_mp - jsonl_entries.append((seq_id, prompt)) - - prompt_file = tmp_path / "prompts.jsonl" - output_file = tmp_path / "outputs_pst.jsonl" - _write_prompts_jsonl(prompt_file, jsonl_entries) - - records = run_infer_subprocess_parallel( - mbridge_checkpoint_path, - prompt_file=prompt_file, - output_file=output_file, - max_new_tokens=num_tokens, - temperature=1.0, - top_k=1, - seed=42, - tensor_parallel_size=1, - prompt_segmentation_threshold=128, - ) - - assert len(records) == len(dna_sequences), f"Expected {len(dna_sequences)} results, got {len(records)}" - - results_by_id = {r["id"]: r for r in records} - match_percents = {} - for seq_id, target in targets_by_id.items(): - assert seq_id in results_by_id, f"Missing result for {seq_id}" - identity = calculate_sequence_identity(target, results_by_id[seq_id]["completion"]) - match_percents[seq_id] = identity - - matchperc_print = {k: f"{v:.2f}%" for k, v in match_percents.items()} - matchperc_print_expected = {k: f"{v:.2f}%" for k, v in expected_by_id.items()} - - assert all(match_percents[sid] >= 0.90 * expected_by_id[sid] for sid in targets_by_id), ( - f"PST accuracy regression: expected at least 90% of {matchperc_print_expected}, got {matchperc_print}" - ) - - @pytest.fixture(scope="module") def mbridge_checkpoint_7b_1m_path(tmp_path_factory) -> Path: """Create or load a MBridge checkpoint for 7b-1m model testing.""" @@ -1117,55 +1084,328 @@ def _run_infer(ckpt: Path, output_file: Path) -> dict: assert base_lp != lora_lp, "LoRA adapter had no effect on completion logprobs" -class TestHyenaInferenceContext: - """Unit tests for the Hyena-specific inference context.""" +def test_hyena_inference_context_initialization(): + """Test that HyenaInferenceContext can be initialized.""" + context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=8192) + assert context is not None + assert context.max_batch_size == 1 + assert context.max_sequence_length == 8192 + + +def test_hyena_inference_context_reset(): + """Test that context reset works without error.""" + context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=8192) + # Add some fake filter state (simulating what hyena layers do) + context.filter_state_dict_layer_0 = {"key": torch.zeros(10)} + context.filter_state_dict_layer_1 = {"key": torch.ones(10)} + + # Verify the state was added + assert hasattr(context, "filter_state_dict_layer_0") + assert hasattr(context, "filter_state_dict_layer_1") + + # Reset should remove all filter_state_dict attributes + context.reset() - def test_context_initialization(self): - """Test that HyenaInferenceContext can be initialized.""" - context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=8192) - assert context is not None - assert context.max_batch_size == 1 - assert context.max_sequence_length == 8192 + assert not hasattr(context, "filter_state_dict_layer_0") + assert not hasattr(context, "filter_state_dict_layer_1") - def test_context_reset(self): - """Test that context reset works without error.""" - context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=8192) - # Add some fake filter state (simulating what hyena layers do) - context.filter_state_dict_layer_0 = {"key": torch.zeros(10)} - context.filter_state_dict_layer_1 = {"key": torch.ones(10)} - # Verify the state was added - assert hasattr(context, "filter_state_dict_layer_0") - assert hasattr(context, "filter_state_dict_layer_1") +def test_hyena_inference_context_materialize_logits_setting(): + """Test that materialize_only_last_token_logits can be configured.""" + context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=8192) - # Reset should remove all filter_state_dict attributes + # Default should be True for efficiency + # We can set it to False if we need full sequence logits + context.materialize_only_last_token_logits = False + assert context.materialize_only_last_token_logits is False + + context.materialize_only_last_token_logits = True + assert context.materialize_only_last_token_logits is True + + +def test_hyena_inference_context_multiple_batches(): + """Test context with different batch sizes.""" + for batch_size in [1, 2, 4]: + context = HyenaInferenceContext(max_batch_size=batch_size, max_sequence_length=4096) + assert context.max_batch_size == batch_size + context.reset() # Should not error + + +def test_hyena_inference_context_different_sequence_lengths(): + """Test context with different max sequence lengths.""" + for seq_len in [1024, 8192, 16384]: + context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=seq_len) + assert context.max_sequence_length == seq_len context.reset() - assert not hasattr(context, "filter_state_dict_layer_0") - assert not hasattr(context, "filter_state_dict_layer_1") - - def test_context_materialize_logits_setting(self): - """Test that materialize_only_last_token_logits can be configured.""" - context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=8192) - - # Default should be True for efficiency - # We can set it to False if we need full sequence logits - context.materialize_only_last_token_logits = False - assert context.materialize_only_last_token_logits is False - - context.materialize_only_last_token_logits = True - assert context.materialize_only_last_token_logits is True - - def test_context_multiple_batches(self): - """Test context with different batch sizes.""" - for batch_size in [1, 2, 4]: - context = HyenaInferenceContext(max_batch_size=batch_size, max_sequence_length=4096) - assert context.max_batch_size == batch_size - context.reset() # Should not error - - def test_context_different_sequence_lengths(self): - """Test context with different max sequence lengths.""" - for seq_len in [1024, 8192, 16384]: - context = HyenaInferenceContext(max_batch_size=1, max_sequence_length=seq_len) - assert context.max_sequence_length == seq_len - context.reset() + +# ============================================================================= +# Native dynamic-inference engine edge-case tests +# ============================================================================= +# These exercise the NATIVE mcore dynamic-inference path (paged-KV attention + Hyena recurrent +# state packed into mcore's two Mamba slots). They run against the small 1b-8k-bf16 fixture +# checkpoint (real weights, validates the mechanism + correctness, not just shapes). Edge cases +# cover full-prompt multi-block prefill (prompt > block_size_tokens), opt-in chunked prefill, +# single-token decode, longer generation, TP-non-divisible batch (batch=1 on TP=2), and +# prompt-shorter-than-the-medium-FIR-ring behavior. Greedy decoding (top_k=1) keeps the +# assertions deterministic. + +# A long DNA prompt (> block_size_tokens=256) that forces multi-block paged-KV prefill. +LONG_DNA_PROMPT = ( + "GAATAGGAACAGCTCCGGTCTACAGCTCCCAGCGTGAGCGACGCAGAAGACGGTGATTTCTGCATTTCCATCTGAGGTACCGGGTTCATCTCACTAGG" + "GAGTGCCAGACAGTGGGCGCAGGCCAGTGTGTGTGCGCACCGTGCGCGAGCCGAAGCAGGGCGAGGCATTGCCTCACCTGGGAAGCGCAAGGGGTCAG" + "GGAGTTCCCTTTCCGAGTCAAAGAAAGGGGTGACGGACGCACCTGGAAAATCGGGTCACTCCCACCCGAATATTGCGCTTTTCAGACCGGCTTAAGAA" + "ACGGCGCACCACGAGACTATATCCCACAC" +) +assert len(LONG_DNA_PROMPT) > 256, "LONG_DNA_PROMPT must exceed block_size_tokens=256 to cover >1 KV block" + +DNA_BASES = set("ACGTacgtNn") + + +def _is_dna_completion(text: str) -> bool: + """True when every character of ``text`` is a DNA base (Evo2's byte vocab).""" + return len(text) > 0 and all(c in DNA_BASES for c in text) + + +def test_native_dynamic_runs(mbridge_checkpoint_path, tmp_path): + """A short prompt generates a non-empty DNA completion through the native engine.""" + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + record = run_infer_subprocess( + mbridge_checkpoint_path, + prompt="ACGTACGTAACCGGTTACGTACGTAACCGGTT", + output_file=tmp_path / "native_runs.jsonl", + max_new_tokens=10, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + ) + assert record["usage"]["prompt_tokens"] > 0 + assert record["usage"]["completion_tokens"] == 10 + assert _is_dna_completion(record["completion"]), f"non-DNA completion: {record['completion']!r}" + + +def test_native_dynamic_full_prefill_multi_block(mbridge_checkpoint_path, tmp_path): + """A prompt longer than block_size_tokens (256) prefills as one multi-block request. + + Without --enable-chunked-prefill, the whole prompt is enqueued as one prefill chunk that + uses multiple 256-token KV blocks. The first forward processes all prompt tokens, and + last_token_logits selects the true final position before decode begins. + """ + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + n_prompt_tokens = len(LONG_DNA_PROMPT) + assert n_prompt_tokens > 256 + record = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=LONG_DNA_PROMPT, + output_file=tmp_path / "native_full_prefill_multi_block.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + ) + # The whole prompt must have been prefilled (multi-block) and 20 tokens generated. + assert record["usage"]["prompt_tokens"] == n_prompt_tokens, ( + f"prompt_tokens {record['usage']['prompt_tokens']} != {n_prompt_tokens}; multi-block " + "prefill did not enqueue the full prompt" + ) + assert record["usage"]["completion_tokens"] == 20 + assert _is_dna_completion(record["completion"]), f"non-DNA completion: {record['completion']!r}" + + +def test_native_dynamic_chunked_prefill_cli_multi_chunk(mbridge_checkpoint_path, tmp_path): + """--enable-chunked-prefill allows prompts to exceed the per-step token budget.""" + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + n_prompt_tokens = len(LONG_DNA_PROMPT) + max_tokens = 256 + assert n_prompt_tokens > max_tokens + record = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=LONG_DNA_PROMPT, + output_file=tmp_path / "native_chunked_prefill.jsonl", + max_new_tokens=4, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + extra_args=[ + "--enable-chunked-prefill", + "--inference-dynamic-batching-max-tokens", + str(max_tokens), + ], + ) + assert record["usage"]["prompt_tokens"] == n_prompt_tokens + assert record["usage"]["completion_tokens"] == 4 + assert _is_dna_completion(record["completion"]), f"non-DNA completion: {record['completion']!r}" + + +def test_native_dynamic_single_token_decode(mbridge_checkpoint_path, tmp_path): + """A single decode step (max_new_tokens=1) produces exactly one token after prefill.""" + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + record = run_infer_subprocess( + mbridge_checkpoint_path, + prompt="ACGTACGTAACCGGTTACGTACGTAACCGGTT", + output_file=tmp_path / "native_single.jsonl", + max_new_tokens=1, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=256, + ) + assert record["usage"]["completion_tokens"] == 1, "expected exactly one decoded token" + assert _is_dna_completion(record["completion"]), f"non-DNA completion: {record['completion']!r}" + + +def test_native_dynamic_short_prompt_under_medium_ring(mbridge_checkpoint_path, tmp_path): + """A prompt shorter than the medium-FIR ring (127) prefills via the right-aligned seed. + + The medium Hyena operator's recurrent FIR ring is 127 wide; a short prompt produces a seed + shorter than the ring. The packed-slot path right-aligns that short seed into the fixed-width + ring (numerically equivalent to the eager grow path for the flip-filter medium operator). This + guards that fix: a ~16-token prompt must still generate a valid DNA completion. + """ + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + record = run_infer_subprocess( + mbridge_checkpoint_path, + prompt="ACGTACGTAACCGGTT", # 16 tokens << 127 (medium ring width) + output_file=tmp_path / "native_short.jsonl", + max_new_tokens=10, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=256, + ) + assert record["usage"]["completion_tokens"] == 10 + assert _is_dna_completion(record["completion"]), f"non-DNA completion: {record['completion']!r}" + + +def test_native_dynamic_long_generation(mbridge_checkpoint_path, tmp_path): + """A longer generation (100 tokens) runs many decode steps without context overflow.""" + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + record = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=PROMPT_1, + output_file=tmp_path / "native_long_gen.jsonl", + max_new_tokens=100, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=1024, + ) + assert record["usage"]["completion_tokens"] == 100, "long generation did not reach 100 tokens" + assert _is_dna_completion(record["completion"]), f"non-DNA completion: {record['completion']!r}" + + +def test_native_dynamic_deterministic(mbridge_checkpoint_path, tmp_path): + """Greedy decoding with the same prompt + seed is reproducible across runs.""" + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + rec1 = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=PROMPT_1, + output_file=tmp_path / "native_det1.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + ) + rec2 = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=PROMPT_1, + output_file=tmp_path / "native_det2.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + ) + assert rec1["completion"] == rec2["completion"], ( + f"native greedy decode not deterministic:\n run1: {rec1['completion']}\n run2: {rec2['completion']}" + ) + + +def test_native_dynamic_different_prompts_differ(mbridge_checkpoint_path, tmp_path): + """Different prompts produce different completions (the model responds to the prompt).""" + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + rec1 = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=PROMPT_1, + output_file=tmp_path / "native_diff1.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + ) + rec2 = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=PROMPT_2, + output_file=tmp_path / "native_diff2.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + ) + assert rec1["completion"] != rec2["completion"], "different prompts produced identical completions" + + +@pytest.mark.slow +@pytest.mark.timeout(600) +def test_native_dynamic_tp2_batch1(mbridge_checkpoint_7b_1m_path, tmp_path): + """TP=2 with a single request (batch=1) runs through decode-only CUDA graphs. + + Evo2 keeps sequence parallelism disabled for standalone inference and sizes each context to + the active request count, while mcore pads decode graph dimensions only as needed for TP + alignment. Needs the 7b checkpoint (32 heads, TP-divisible) + 2 GPUs. + """ + tp = 2 + if torch.cuda.device_count() < tp: + pytest.skip(f"TP={tp} requires {tp} GPUs, have {torch.cuda.device_count()}") + open_port = find_free_network_port() + output_file = tmp_path / "native_tp2.jsonl" + cmd = [ + "torchrun", + "--nproc_per_node", + str(tp), + "--nnodes", + "1", + "--master_port", + str(open_port), + str(_infer_script_path()), + "--ckpt-dir", + str(mbridge_checkpoint_7b_1m_path), + "--prompt", + "ACGTACGTAACCGGTTACGTACGTAACCGGTT", + "--max-new-tokens", + "10", + "--output-file", + str(output_file), + "--temperature", + "1.0", + "--top-k", + "1", + "--seed", + "42", + "--tensor-parallel-size", + str(tp), + "--max-seq-length", + "256", + ] + env = copy.deepcopy(PRETEST_ENV) + env["PYTHONPATH"] = str(_recipe_root() / "src") + os.pathsep + env.get("PYTHONPATH", "") + result = subprocess.run(cmd, check=False, capture_output=True, text=True, timeout=600, env=env) + assert result.returncode == 0, f"native TP=2 infer failed:\nstdout: {result.stdout}\nstderr: {result.stderr}" + records = _read_jsonl_results(output_file) + assert len(records) == 1 + assert records[0]["usage"]["completion_tokens"] == 10 + assert _is_dna_completion(records[0]["completion"]), f"non-DNA completion: {records[0]['completion']!r}" diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py index 1e2d9e3347..13f6d4de65 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py @@ -578,7 +578,7 @@ def test_batch_generate_coding_sequences( expected_matchpercents: list[float], fp8: bool, ): - """Test generation on coding sequences using MCore inference infrastructure. + """Test generation on coding sequences through the Evo2 dynamic-inference endpoint. This test validates that the model can generate reasonable coding sequence continuations, checking for proper stop codon placement and sequence identity. @@ -630,7 +630,7 @@ def test_batch_generate_coding_sequences( # Extract prompts for generation prompts = [split[0] for split in seq_prompts] - # Setup MCore inference engine with batch size matching number of prompts + # Setup the public Evo2 generation endpoint; generation is driven by the native dynamic path. batch_size = len(prompts) // 2 components = setup_inference_engine( ckpt_dir=mbridge_ckpt_path, @@ -640,7 +640,7 @@ def test_batch_generate_coding_sequences( random_seed=42, ) - # Generate all sequences - engine handles iteration internally + # Generate all sequences through the public endpoint. results = generate( components, prompts=prompts, @@ -697,7 +697,7 @@ def test_batch_generate_coding_sequences( # ============================================================================= -# MBridge-based generation tests using HyenaInferenceContext +# MBridge-based generation tests using the public Evo2 dynamic-inference endpoint # ============================================================================= @@ -744,14 +744,14 @@ def test_batch_generate_mbridge( expected_matchpercents: list[float], fp8: bool, ): - """Test autoregressive generation using MCore inference infrastructure. + """Test autoregressive generation through the Evo2 dynamic-inference endpoint. This test validates that the model can generate reasonable continuations - of DNA sequences using the StaticInferenceEngine and TextGenerationController. + of DNA sequences using the same setup_inference_engine/generate API exposed by the standalone `infer_evo2` CLI. - Note: Hyena/Evo2 SSM state caching currently only supports batch size 1, - so prompts are processed sequentially. The MCore inference engine handles - this internally through legacy mode. + Note: setup_inference_engine wires the model onto the native dynamic path, + so this test exercises request creation, Hyena state binding, and decode + through the same endpoint used by the standalone CLI. Uses the same expected values as the original NeMo test_batch_generate. """ @@ -795,8 +795,8 @@ def test_batch_generate_mbridge( prompts = [split[0] for split in seq_splits] targets = [split[1] for split in seq_splits] - # Setup MCore inference engine - # Note: max_batch_size=1 due to Hyena SSM state constraints, but engine handles iteration + # Setup the public Evo2 generation endpoint. + # max_batch_size=1 keeps this memory-heavy test bounded. components = setup_inference_engine( ckpt_dir=mbridge_ckpt_path, max_seq_length=8192, @@ -805,7 +805,7 @@ def test_batch_generate_mbridge( random_seed=42, ) - # Generate all sequences - engine handles iteration internally with max_batch_size=1 + # Generate all sequences through the public endpoint. results = generate( components, prompts=prompts, From 7bce12c830d263211ee9b614a0ecefa1429376b9 Mon Sep 17 00:00:00 2001 From: John St John Date: Tue, 2 Jun 2026 19:50:41 -0700 Subject: [PATCH 02/10] Address feedback around RNG setting Signed-off-by: John St John --- .../evo2_megatron/src/bionemo/evo2/run/infer.py | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py index 5e61c90f1b..31d11e710b 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py @@ -276,6 +276,7 @@ class Evo2NativeDynamicComponents: forward_model: torch.nn.Module hyena_model: torch.nn.Module max_seq_length: int + evo2_seed: int cuda_graphs_enabled: bool cuda_graph_manager_count: int @@ -302,6 +303,7 @@ def _setup_native_dynamic_components( model: torch.nn.Module, raw_model: torch.nn.Module, max_seq_length: int, + evo2_seed: int, cuda_graphs_enabled: bool, ) -> Evo2NativeDynamicComponents: """Prepare the standalone HyenaModel to decode on an Evo2 dynamic context. @@ -344,6 +346,7 @@ def _setup_native_dynamic_components( forward_model=model, hyena_model=hyena_model, max_seq_length=max_seq_length, + evo2_seed=evo2_seed, cuda_graphs_enabled=cuda_graphs_enabled, cuda_graph_manager_count=cuda_graph_manager_count, ) @@ -593,6 +596,7 @@ def setup_inference_engine( model=model, raw_model=raw_model, max_seq_length=max_seq_length, + evo2_seed=random_seed, cuda_graphs_enabled=cuda_graphs_enabled, ) return Evo2InferenceComponents( @@ -786,7 +790,7 @@ def _generate_native_dynamic( eff_top_k = max(0, int(top_k)) eff_top_p = float(top_p) if (top_p and top_p > 0 and eff_top_k == 0) else 0.0 sampling_rng = torch.Generator(device=device) - sampling_rng.manual_seed(int(getattr(tokenizer, "_evo2_seed", 0)) or 1234) + sampling_rng.manual_seed(int(nd.evo2_seed)) results: List[_NativeDynamicResult] = [] for prompt in prompts: @@ -1254,10 +1258,6 @@ def infer( random_seed=random_seed, use_subquadratic_ops=use_subquadratic_ops, ) - # Thread the resolved seed into the native sampler RNG (read off the tokenizer handle in - # _generate_native_dynamic). - components.tokenizer._evo2_seed = random_seed - mem_after_setup_gb = torch.cuda.max_memory_allocated() / (1024**3) logger.info(f"[MEMORY] After model setup: peak={mem_after_setup_gb:.3f} GB") From bd53980cb3fc36345befa62fb3caf9d1896c98bf Mon Sep 17 00:00:00 2001 From: John St John Date: Tue, 2 Jun 2026 20:06:23 -0700 Subject: [PATCH 03/10] Handle mcore dynamic inference context padding in the hyena mixer Signed-off-by: John St John --- .../evo2/models/megatron/hyena/hyena_mixer.py | 38 ++++++++++++++++ .../models/megatron/hyena/test_hyena_mixer.py | 45 ++++++++++++++++++- 2 files changed, 82 insertions(+), 1 deletion(-) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py index 3d21cf37ba..38f2a53b8e 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_mixer.py @@ -43,6 +43,42 @@ logger = logging.getLogger(__name__) +def _dynamic_context_real_token_count(inference_context, padded_token_count: int) -> int: + """Return real active tokens in a dynamic-context flattened token batch.""" + if inference_context is None: + return padded_token_count + is_static_batching = getattr(inference_context, "is_static_batching", None) + if is_static_batching is None or is_static_batching(): + return padded_token_count + + active_token_count = getattr(inference_context, "active_token_count", padded_token_count) + if torch.is_tensor(active_token_count): + if active_token_count.numel() != 1: + return padded_token_count + active_token_count = active_token_count.item() + try: + active_token_count = int(active_token_count) + except (TypeError, ValueError): + return padded_token_count + return max(1, min(active_token_count, padded_token_count)) + + +def _slice_padded_dynamic_context_tokens(features: torch.Tensor, inference_context) -> tuple[torch.Tensor, int]: + """Drop dynamic-context dummy token rows before Hyena recurrent state updates.""" + padded_token_count = int(features.shape[-1]) + real_token_count = _dynamic_context_real_token_count(inference_context, padded_token_count) + if real_token_count == padded_token_count: + return features, padded_token_count + return features[..., :real_token_count].contiguous(), padded_token_count + + +def _pad_padded_dynamic_context_tokens(z: torch.Tensor, padded_token_count: int) -> torch.Tensor: + """Restore MCore's padded token width after Hyena recurrent computation.""" + if z.shape[-1] >= padded_token_count: + return z + return F.pad(z, (0, padded_token_count - z.shape[-1])) + + try: from transformer_engine.common.recipe import DelayedScaling, Format except ImportError: @@ -397,6 +433,7 @@ def forward(self, x, layer_past=None, inference_context=None, _hyena_use_cp=True features = subquadratic_ops_rearrange(features, bhl_to_lbh=False) else: features = rearrange(features, "l b d -> b d l").contiguous() + features, padded_dynamic_token_count = _slice_padded_dynamic_context_tokens(features, inference_context) is_b2b_eligible = self.use_subquadratic_ops and self.operator_type in [ "hyena_short_conv", @@ -421,6 +458,7 @@ def forward(self, x, layer_past=None, inference_context=None, _hyena_use_cp=True ) z = self.mixer(x1, x2, v, _hyena_use_cp=_proj_use_cp, inference_context=inference_context) + z = _pad_padded_dynamic_context_tokens(z, padded_dynamic_token_count) if self.use_subquadratic_ops: z = subquadratic_ops_rearrange(z, bhl_to_lbh=True) else: diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py index 1df1b6b8a7..5ea19e1224 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py @@ -19,7 +19,11 @@ from bionemo.evo2.models.evo2_provider import HyenaNVTestModelProvider, HyenaTestModelProvider from bionemo.evo2.models.megatron.hyena.hyena_config import HyenaConfig from bionemo.evo2.models.megatron.hyena.hyena_layer_specs import hyena_stack_spec_no_te -from bionemo.evo2.models.megatron.hyena.hyena_mixer import HyenaMixer +from bionemo.evo2.models.megatron.hyena.hyena_mixer import ( + HyenaMixer, + _pad_padded_dynamic_context_tokens, + _slice_padded_dynamic_context_tokens, +) from ....utils import distributed_model_parallel_state @@ -84,6 +88,45 @@ def _create_hyena_mixer( ) +class _FakeDynamicContext: + def __init__(self, active_token_count: int, *, static: bool = False): + self.active_token_count = active_token_count + self._static = static + + def is_static_batching(self) -> bool: + return self._static + + +def test_slice_padded_dynamic_context_tokens_keeps_only_real_rows() -> None: + features = torch.arange(1 * 3 * 4, dtype=torch.float32).reshape(1, 3, 4) + + sliced, padded_token_count = _slice_padded_dynamic_context_tokens(features, _FakeDynamicContext(2)) + + assert padded_token_count == 4 + assert sliced.shape == (1, 3, 2) + torch.testing.assert_close(sliced, features[..., :2]) + + +def test_slice_padded_dynamic_context_tokens_keeps_static_width() -> None: + features = torch.arange(1 * 3 * 4, dtype=torch.float32).reshape(1, 3, 4) + + sliced, padded_token_count = _slice_padded_dynamic_context_tokens(features, _FakeDynamicContext(2, static=True)) + + assert padded_token_count == 4 + assert sliced.shape == features.shape + torch.testing.assert_close(sliced, features) + + +def test_pad_padded_dynamic_context_tokens_restores_dummy_width() -> None: + z = torch.ones((1, 3, 2), dtype=torch.float32) + + padded = _pad_padded_dynamic_context_tokens(z, 4) + + assert padded.shape == (1, 3, 4) + torch.testing.assert_close(padded[..., :2], z) + torch.testing.assert_close(padded[..., 2:], torch.zeros((1, 3, 2))) + + @skip_if_no_gpu def test_mixer_initialization(test_config: HyenaTestModelProvider, hyena_config: HyenaConfig, operator_type: str): """Test proper initialization of HyenaMixer with different configurations.""" From ac4d138f1e981c9212f68eb3a9ce47542d45371b Mon Sep 17 00:00:00 2001 From: John St John Date: Tue, 2 Jun 2026 20:25:15 -0700 Subject: [PATCH 04/10] Add docstrings to tests Signed-off-by: John St John --- .../bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py | 3 +++ 1 file changed, 3 insertions(+) diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py index 5ea19e1224..aecbb377c7 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_mixer.py @@ -98,6 +98,7 @@ def is_static_batching(self) -> bool: def test_slice_padded_dynamic_context_tokens_keeps_only_real_rows() -> None: + """Dynamic-context dummy token rows are excluded before Hyena recurrence.""" features = torch.arange(1 * 3 * 4, dtype=torch.float32).reshape(1, 3, 4) sliced, padded_token_count = _slice_padded_dynamic_context_tokens(features, _FakeDynamicContext(2)) @@ -108,6 +109,7 @@ def test_slice_padded_dynamic_context_tokens_keeps_only_real_rows() -> None: def test_slice_padded_dynamic_context_tokens_keeps_static_width() -> None: + """Static contexts keep the full input width.""" features = torch.arange(1 * 3 * 4, dtype=torch.float32).reshape(1, 3, 4) sliced, padded_token_count = _slice_padded_dynamic_context_tokens(features, _FakeDynamicContext(2, static=True)) @@ -118,6 +120,7 @@ def test_slice_padded_dynamic_context_tokens_keeps_static_width() -> None: def test_pad_padded_dynamic_context_tokens_restores_dummy_width() -> None: + """Hyena mixer output is padded back to MCore's graph width.""" z = torch.ones((1, 3, 2), dtype=torch.float32) padded = _pad_padded_dynamic_context_tokens(z, 4) From dab433e559dd349f486ce1f77adf6e2e4c169c00 Mon Sep 17 00:00:00 2001 From: "John St. John" Date: Wed, 3 Jun 2026 17:50:36 -0700 Subject: [PATCH 05/10] Address CI failures Signed-off-by: John St. John --- .../evo2_megatron/examples/evo2_classifier.py | 11 +- .../src/bionemo/evo2/run/infer.py | 438 +++++++++++++++--- .../tests/bionemo/evo2/test_evo2.py | 217 +++++++++ 3 files changed, 600 insertions(+), 66 deletions(-) diff --git a/bionemo-recipes/recipes/evo2_megatron/examples/evo2_classifier.py b/bionemo-recipes/recipes/evo2_megatron/examples/evo2_classifier.py index 3a1c46f631..e86259f069 100644 --- a/bionemo-recipes/recipes/evo2_megatron/examples/evo2_classifier.py +++ b/bionemo-recipes/recipes/evo2_megatron/examples/evo2_classifier.py @@ -72,7 +72,7 @@ get_checkpoint_run_config_filename, read_run_config, ) -from megatron.bridge.utils.instantiate_utils import instantiate +from megatron.bridge.utils.instantiate_utils import instantiate, register_allowed_target_prefix from megatron.bridge.utils.vocab_utils import calculate_padded_vocab_size from megatron.core import dist_checkpointing, parallel_state from megatron.core.num_microbatches_calculator import destroy_num_microbatches_calculator @@ -97,6 +97,15 @@ logger: logging.Logger = logging.getLogger(__name__) +# This example is launched as ``evo2_classifier.py`` (e.g. ``torchrun ... evo2_classifier.py``), so +# the providers defined below are serialized into a trained checkpoint's run_config with a +# ``_target_`` of ``evo2_classifier.``. Megatron-Bridge's ``instantiate`` only resolves +# targets under an allow-listed module prefix, so register this module's prefix here (mirroring +# ``bionemo.evo2.`` in evo2_provider.py). Without it, rebuilding the model at predict time in +# ``_build_classifier_from_checkpoint`` raises InstantiationException. +register_allowed_target_prefix("evo2_classifier.") + + # ───────────────────────────────────────────────────────────────────────────── # Model: subclass of HyenaModel with a classification head # ───────────────────────────────────────────────────────────────────────────── diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py index 31d11e710b..13cda85044 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py @@ -228,6 +228,21 @@ def _resolve_int(cli_val: Optional[int], env_var: str, auto_default: Optional[in return auto_default +# Small slack added on top of (prompt_len + max_new_tokens) when auto-sizing the context, matching the +# headroom the per-prompt path historically used. +_AUTO_MAX_SEQ_LENGTH_HEADROOM = 8 + +# Default number of leading prompts scanned to auto-size max_seq_length when no manual value is given. +# Tokenizing this many prompt strings is cheap; prompts beyond it are validated lazily and error loudly +# (naming the --max-seq-length to set) if one needs a larger context. Pass 0 to scan every prompt. +_DEFAULT_AUTO_MAX_SEQ_LENGTH_NUM_PROMPTS = 50 + + +def _auto_max_seq_length_for(prompt_token_count: int, max_new_tokens: int) -> int: + """Context length needed to fully serve a prompt of ``prompt_token_count`` tokens + its generation.""" + return int(prompt_token_count) + int(max_new_tokens) + _AUTO_MAX_SEQ_LENGTH_HEADROOM + + def _prune_caches() -> None: """Run ``gc.collect()`` and ``torch.cuda.empty_cache()`` to free fragmented memory. @@ -275,10 +290,22 @@ class Evo2NativeDynamicComponents: mamba_state_config: Any forward_model: torch.nn.Module hyena_model: torch.nn.Module - max_seq_length: int + # Engine sequence-length budget. ``None`` means "auto": resolved from the prompts (longest prompt + # + max_new_tokens + headroom) the first time generation runs, then frozen for the engine lifetime + # (the CUDA-graphed context cannot grow). A concrete value is a manual cap that supersedes auto. + max_seq_length: Optional[int] evo2_seed: int cuda_graphs_enabled: bool cuda_graph_manager_count: int + # Persistent dynamic context, built lazily on the first generate() call and reused across all + # subsequent calls so the per-layer CUDA graphs (captured once during warmup) stay valid. Keyed + # by the context-affecting generate() options so it is rebuilt only if those change. + shared_dyn_ctx: Optional[Any] = None + shared_dyn_ctx_key: Optional[tuple] = None + # True when ``max_seq_length`` was auto-sized from prompts (vs a manual cap). In auto mode a prompt + # that needs more than the frozen budget is a hard error (the context cannot grow); in manual mode + # the request just stops early on overflow, as before. + max_seq_length_is_auto: bool = False # ============================================================================= @@ -302,7 +329,7 @@ def _setup_native_dynamic_components( *, model: torch.nn.Module, raw_model: torch.nn.Module, - max_seq_length: int, + max_seq_length: Optional[int], evo2_seed: int, cuda_graphs_enabled: bool, ) -> Evo2NativeDynamicComponents: @@ -310,9 +337,9 @@ def _setup_native_dynamic_components( This disables sequence parallelism for the Evo2 model, builds the exact-rounding ``DynamicInferenceContext`` subclass, and creates the Mamba state config that lets mcore - allocate Hyena recurrent state in its dynamic state buffers. Per-prompt contexts are built - lazily in :func:`_generate_native_dynamic` so each request can be sized to its prompt and - requested generation length. + allocate Hyena recurrent state in its dynamic state buffers. A single dynamic context is built + lazily in :func:`_generate_native_dynamic`, sized to the longest prompt plus the requested + generation length, and reused (reset) across prompts so CUDA-graph capture stays valid. """ rank = int(os.environ.get("RANK", "0")) hyena_model = _unwrap_hyena_model(model) @@ -349,6 +376,7 @@ def _setup_native_dynamic_components( evo2_seed=evo2_seed, cuda_graphs_enabled=cuda_graphs_enabled, cuda_graph_manager_count=cuda_graph_manager_count, + max_seq_length_is_auto=max_seq_length is None, ) @@ -417,7 +445,7 @@ def _force_exit_after_cuda_graph_inference() -> None: def setup_inference_engine( ckpt_dir: Path, *, - max_seq_length: int = 8192, + max_seq_length: Optional[int] = None, max_batch_size: int = 1, tensor_parallel_size: int = 1, pipeline_model_parallel_size: int = 1, @@ -436,7 +464,12 @@ def setup_inference_engine( Args: ckpt_dir: Path to MBridge checkpoint directory. - max_seq_length: Maximum sequence length for generation. + max_seq_length: Engine sequence-length budget for the persistent dynamic context. ``None`` + (default) auto-sizes it from the prompts at the first :func:`generate` call (longest + prompt + ``max_new_tokens`` + headroom); a concrete value is a manual cap that supersedes + auto-sizing. The context is CUDA-graph-pinned, so the budget cannot change in place — in + auto mode a later prompt that needs more triggers a one-time rebuild + graph re-capture at + a larger size; a manual cap never grows (an over-long prompt then just stops early). max_batch_size: Maximum batch size for inference. tensor_parallel_size: Tensor parallelism degree. pipeline_model_parallel_size: Pipeline parallelism degree. @@ -742,6 +775,184 @@ def _modify_for_top_p(logits, p): return sampled +def _warmup_native_dynamic_cuda_graphs(nd: Evo2NativeDynamicComponents, dyn_ctx: Any, device: torch.device) -> None: + """Capture the per-layer decode CUDA graph(s) up front on a throwaway request. + + mcore captures each per-layer decode CUDA graph lazily on the first decode step that matches the + graph's batch dimensions, and that capture runs warmup iterations of the layer forward. For Evo2 + those warmup iterations advance the in-place Hyena recurrent state, so if capture happened on the + first *real* prompt's decode it would corrupt that prompt's output (later prompts, whose decode + just replays the captured graph, are unaffected). mcore's ``DynamicInferenceEngine`` avoids this + by capturing graphs up front in ``create_cuda_graphs()`` with throwaway requests; the standalone + Evo2 loop does the equivalent here. + + Unlike a plain attention model, the captured decode graph must read and write the Hyena recurrent + state through the packed mamba-slot views, so the throwaway request is *prefilled* first (binding + those views and seeding the recurrent state, which selects the decode code path) and then decoded + a couple of steps to trigger and replay capture. The context is reset afterwards, discarding the + throwaway state; the captured graph (held on the model's layers) is then reused by every real + prompt. Only the public context primitives the real decode loop already uses are exercised here, + so this does not depend on mcore's internal cuda-graph-warmup helpers. + """ + from megatron.core.inference.inference_request import DynamicInferenceRequest + + forward_model = nd.forward_model + hyena_model = nd.hyena_model + rank = int(os.environ.get("RANK", "0")) + + # A short throwaway prompt is enough: the decode CUDA graph shape is independent of prompt length. + n_warmup_prompt_tokens = max(1, min(8, int(dyn_ctx.max_tokens))) + try: + with torch.inference_mode(): + req = DynamicInferenceRequest( + request_id=0, + prompt_tokens=torch.zeros(n_warmup_prompt_tokens, dtype=torch.int64, device=device), + sampling_params=SamplingParams(num_tokens_to_generate=8, termination_id=-1), + ) + dyn_ctx.add_request(req, prefill_chunk_length=n_warmup_prompt_tokens) + slot = int(dyn_ctx.mamba_metadata.request_to_mamba_state_idx[0].item()) + bind_hyena_packed_views_to_dynamic_context(hyena_model, dyn_ctx, request_slot=slot) + # One prefill forward (eager; not graphed) seeds the Hyena recurrent state, then two decode + # forwards: the first triggers graph capture, the second replays it so any capture/replay + # mismatch surfaces here rather than on a user prompt. + for _step in range(3): + dyn_ctx.initialize_attention_state() + input_ids, position_ids = dyn_ctx.current_input_and_position_ids() + try: + from megatron.core.inference.utils import InferenceMode + + inference_mode_context = InferenceMode.active() + except ImportError: + inference_mode_context = contextlib.nullcontext() + with inference_mode_context: + forward_model( + input_ids, + position_ids, + None, + inference_context=dyn_ctx, + runtime_gather_output=True, + ) + dyn_ctx.update_requests( + torch.ones(1, dtype=torch.bool, device=device), + torch.zeros(1, dtype=torch.int64, device=device), + ) + finally: + dyn_ctx.reset() + if rank == 0: + logger.info("[evo2-native-cg] captured decode CUDA graph(s) via throwaway warmup request") + + +def _reset_layer_cuda_graphs(nd: Evo2NativeDynamicComponents) -> None: + """Drop all captured per-layer CUDA graphs so the next warmup re-captures at the new context size. + + Needed to "grow" the dynamic context (mcore has no in-place resize): a larger context is a new + object with a longer ``rotary_pos_emb``, so graphs captured against the previous one must go. + mcore's module-level ``delete_cuda_graphs()`` resets the global record, each runner's recorded + graph, and the shared mempool — but it does NOT clear each layer ``CudaGraphManager``'s per-instance + ``cudagraph_runners`` / ``inference_cudagraphs_lookup_table``, so a stale runner would still be + found and replayed against the new context (raising "CUDA graph argument mismatch"). We clear those + per-manager structures first; with the global ``cudagraph_created`` flag also reset, the next decode + creates a fresh runner and captures at the current shape. Done defensively so a future mcore that + renames these internals degrades to a clear capture-time error rather than silent misbehavior. + """ + for module in nd.hyena_model.modules(): + mgr = getattr(module, "cudagraph_manager", None) + if mgr is None: + continue + if hasattr(mgr, "cudagraph_runners"): + mgr.cudagraph_runners = [] + lookup_table = getattr(mgr, "inference_cudagraphs_lookup_table", None) + if lookup_table is not None: + lookup_table.clear() + + from megatron.core.transformer.cuda_graphs import delete_cuda_graphs + + delete_cuda_graphs() + + +def _get_or_build_shared_dynamic_context( + nd: Evo2NativeDynamicComponents, + *, + block_size_tokens: int, + max_tokens: Optional[int], + enable_chunked_prefill: bool, + device: torch.device, +) -> Any: + """Return the engine's persistent dynamic context, building (and graph-warming) it on first use. + + A single context is reused for the whole engine lifetime so the per-layer CUDA graphs captured + during warmup stay valid across every prompt and every :func:`generate` call (mcore keys decode + graphs by the context object plus a ``rotary_pos_emb`` tensor whose length equals + ``max_sequence_length``, so both must stay constant). This mirrors mcore's + ``DynamicInferenceEngine``, which holds one context and feeds many requests through it. + + It is rebuilt only when (a) the context-affecting options change, or (b) the engine budget + ``nd.max_seq_length`` has grown beyond the cached context (auto mode grows on demand). mcore has + no in-place resize, so "grow" means building a new, larger context; any graphs captured against + the old one are dropped first via :func:`_reset_layer_cuda_graphs` and re-captured by the warmup. + """ + from megatron.core.inference.config import InferenceConfig + + ctx_key = ( + int(block_size_tokens), + None if max_tokens is None else int(max_tokens), + bool(enable_chunked_prefill), + ) + cached = nd.shared_dyn_ctx + if ( + cached is not None + and nd.shared_dyn_ctx_key == ctx_key + and int(cached.max_sequence_length) >= int(nd.max_seq_length) + ): + # Reuse the persistent context (it is big enough); reset() returns it to a clean state without + # freeing the CUDA-graph-referenced buffers (it is explicitly designed for reuse-after-capture). + cached.reset() + return cached + + # First build, config change, or grow. Drop any graphs captured against the previous context + # object so a stale graph can never be replayed against the new (larger) one. + if cached is not None and nd.cuda_graphs_enabled: + _reset_layer_cuda_graphs(nd) + + hyena_model = nd.hyena_model + # max_requests is kept tp-divisible (max(tp,1)); the per-context exact rounder still decodes the + # single active request as ONE row. Size to the engine's full max_seq_length so the persistent + # context (and its constant rotary length) can serve any prompt across any batch. + tp = int(getattr(hyena_model.config, "tensor_model_parallel_size", 1) or 1) + max_requests = max(tp, 1) + msl = int(nd.max_seq_length) + buf_gb = compute_evo2_paged_kv_buffer_size_gb( + hyena_model.config, + mamba_state_config=nd.mamba_state_config, + max_sequence_length=msl, + max_requests=max_requests, + block_size_tokens=block_size_tokens, + safety_blocks=2, + ) + dyn_ctx = nd.ctx_cls( + model_config=hyena_model.config, + inference_config=InferenceConfig( + max_sequence_length=msl, + buffer_size_gb=buf_gb, + mamba_inference_state_config=nd.mamba_state_config, + max_requests=max_requests, + max_tokens=max_tokens, + block_size_tokens=block_size_tokens, + unified_memory_level=0, + enable_chunked_prefill=enable_chunked_prefill, + num_cuda_graphs=1 if nd.cuda_graphs_enabled else None, + use_cuda_graphs_for_non_decode_steps=False, + ), + ) + dyn_ctx.materialize_only_last_token_logits = False + dyn_ctx.initialize_all_tensors() + if nd.cuda_graphs_enabled: + _warmup_native_dynamic_cuda_graphs(nd, dyn_ctx, device) + nd.shared_dyn_ctx = dyn_ctx + nd.shared_dyn_ctx_key = ctx_key + return dyn_ctx + + def _generate_native_dynamic( components: Evo2InferenceComponents, prompts: List[str], @@ -757,7 +968,8 @@ def _generate_native_dynamic( ) -> List[_NativeDynamicResult]: """Drive standalone Evo2 (text→DNA) generation through the native mcore dynamic engine. - One mcore ``DynamicInferenceContext`` per prompt, driven through the request lifecycle: + A single mcore ``DynamicInferenceContext`` is reused across prompts, driven through the request + lifecycle once per prompt: ``add_request`` -> :func:`bind_hyena_packed_views_to_dynamic_context` -> ``initialize_attention_state`` -> model forward -> sample on the LM-head logits -> ``update_requests``. Standalone Evo2 has its own output layer (``post_process=True``), so @@ -770,7 +982,6 @@ def _generate_native_dynamic( prefill chunk length. """ # lazy: heavy mcore imports — pull the full dynamic-inference stack only when generating. - from megatron.core.inference.config import InferenceConfig from megatron.core.inference.contexts.dynamic_context import ( BlockOverflowError, MaxSequenceLengthOverflowError, @@ -793,60 +1004,83 @@ def _generate_native_dynamic( sampling_rng.manual_seed(int(nd.evo2_seed)) results: List[_NativeDynamicResult] = [] - for prompt in prompts: - prompt_token_ids = list(tokenizer.tokenize(prompt)) - n_prompt = len(prompt_token_ids) - # Size the context to cover prompt + generation (+ small headroom). max_requests is kept - # tp-divisible (max(tp,1)); the per-context exact rounder decodes the single request as ONE - # row regardless. buffer_size_gb is auto-sized for the prompt plus generated tokens. - tp = int(getattr(hyena_model.config, "tensor_model_parallel_size", 1) or 1) - max_requests = max(tp, 1) - msl = min(nd.max_seq_length, n_prompt + max_new_tokens + 8) - if msl < n_prompt + 1: - msl = n_prompt + max_new_tokens + 8 - block_size_tokens = int(inference_dynamic_batching_block_size) - if block_size_tokens <= 0: - raise ValueError(f"inference_dynamic_batching_block_size must be positive, got {block_size_tokens}") - max_tokens = inference_dynamic_batching_max_tokens - if max_tokens is not None: - max_tokens = int(max_tokens) - if max_tokens <= 0: - raise ValueError(f"inference_dynamic_batching_max_tokens must be positive, got {max_tokens}") - if n_prompt > max_tokens and not enable_chunked_prefill: - raise ValueError( - f"Prompt has {n_prompt} tokens but inference_dynamic_batching_max_tokens={max_tokens}. " - "Increase --inference-dynamic-batching-max-tokens or pass --enable-chunked-prefill." - ) - buf_gb = compute_evo2_paged_kv_buffer_size_gb( - hyena_model.config, - mamba_state_config=nd.mamba_state_config, - max_sequence_length=msl, - max_requests=max_requests, - block_size_tokens=block_size_tokens, - safety_blocks=2, - ) - dyn_ctx = nd.ctx_cls( - model_config=hyena_model.config, - inference_config=InferenceConfig( - max_sequence_length=msl, - buffer_size_gb=buf_gb, - mamba_inference_state_config=nd.mamba_state_config, - max_requests=max_requests, - max_tokens=max_tokens, - block_size_tokens=block_size_tokens, - unified_memory_level=0, - enable_chunked_prefill=enable_chunked_prefill, - num_cuda_graphs=1 if nd.cuda_graphs_enabled else None, - use_cuda_graphs_for_non_decode_steps=False, - ), - ) - if n_prompt > dyn_ctx.max_tokens and not enable_chunked_prefill: + if not prompts: + return results + + # Tokenize every prompt up front so the token-budget checks below run before any generation and + # so the shared context's max-token budget can be validated against the longest prompt. + tokenized_prompts: List[List[int]] = [list(tokenizer.tokenize(prompt)) for prompt in prompts] + max_n_prompt = max(len(toks) for toks in tokenized_prompts) + + block_size_tokens = int(inference_dynamic_batching_block_size) + if block_size_tokens <= 0: + raise ValueError(f"inference_dynamic_batching_block_size must be positive, got {block_size_tokens}") + max_tokens = inference_dynamic_batching_max_tokens + if max_tokens is not None: + max_tokens = int(max_tokens) + if max_tokens <= 0: + raise ValueError(f"inference_dynamic_batching_max_tokens must be positive, got {max_tokens}") + if max_n_prompt > max_tokens and not enable_chunked_prefill: raise ValueError( - f"Prompt has {n_prompt} tokens but the dynamic context max token budget is {dyn_ctx.max_tokens}. " + f"Longest prompt has {max_n_prompt} tokens but inference_dynamic_batching_max_tokens={max_tokens}. " "Increase --inference-dynamic-batching-max-tokens or pass --enable-chunked-prefill." ) - dyn_ctx.materialize_only_last_token_logits = False - dyn_ctx.initialize_all_tensors() + + # Resolve the engine sequence-length budget. In auto mode (max_seq_length=None at setup) it is + # sized from the prompts on first use and then GROWS on demand: a later prompt that needs more + # triggers a one-time rebuild of the dynamic context at a larger size (mcore has no in-place + # resize) with a CUDA-graph re-capture, instead of failing. A manual --max-seq-length is a fixed + # cap that supersedes auto-sizing and never grows (an over-long prompt then just stops early, as + # before). The CLI may pre-size nd.max_seq_length from a prompt sample (_resolve_prompt_auto...). + needed_max_seq_length = _auto_max_seq_length_for(max_n_prompt, max_new_tokens) + if nd.max_seq_length is None: + nd.max_seq_length = needed_max_seq_length + if rank == 0: + logger.info( + "[evo2-native] auto-sized max_seq_length=%d (longest prompt=%d + max_new_tokens=%d + headroom=%d)", + nd.max_seq_length, + max_n_prompt, + max_new_tokens, + _AUTO_MAX_SEQ_LENGTH_HEADROOM, + ) + elif nd.max_seq_length_is_auto and needed_max_seq_length > nd.max_seq_length: + # Grow to cover this prompt, rounded up to a whole KV block so a small bump doesn't re-trigger + # a rebuild on the very next slightly-longer prompt. _get_or_build_... rebuilds + re-captures. + grown_max_seq_length = -(-needed_max_seq_length // block_size_tokens) * block_size_tokens + if rank == 0: + logger.info( + "[evo2-native] growing max_seq_length %d -> %d to fit a larger prompt (%d tokens); this " + "rebuilds the dynamic context and re-captures CUDA graphs once. Pass --max-seq-length to " + "pin a fixed size and avoid regrows.", + nd.max_seq_length, + grown_max_seq_length, + max_n_prompt, + ) + nd.max_seq_length = grown_max_seq_length + + # One persistent dynamic context for the whole engine, reused across every prompt AND every + # generate() call (mcore's DynamicInferenceEngine pattern: one context fed many requests). This is + # required for CUDA-graph correctness — the per-layer decode graph, captured once during warmup, + # freezes the context object identity and the rotary_pos_emb shape (== max_sequence_length), so the + # same object and shape must be presented on every later decode step regardless of prompt or batch. + # reset() (called between prompts in the loop below, and on reuse) returns the context to a clean + # state without freeing the graph-referenced buffers. + dyn_ctx = _get_or_build_shared_dynamic_context( + nd, + block_size_tokens=block_size_tokens, + max_tokens=max_tokens, + enable_chunked_prefill=enable_chunked_prefill, + device=device, + ) + if max_n_prompt > dyn_ctx.max_tokens and not enable_chunked_prefill: + raise ValueError( + f"Longest prompt has {max_n_prompt} tokens but the dynamic context max token budget is " + f"{dyn_ctx.max_tokens}. Increase --inference-dynamic-batching-max-tokens or pass " + "--enable-chunked-prefill." + ) + + for prompt_token_ids in tokenized_prompts: + n_prompt = len(prompt_token_ids) generated_ids: List[int] = [] generated_logprobs: List[float] = [] @@ -1141,8 +1375,18 @@ def parse_args() -> argparse.Namespace: "--max-seq-length", type=int, default=None, - help="Max sequence length. When omitted, resolved as: " - "EVO2_MAX_SEQ_LEN env var > auto-detected from GPU memory and model size.", + help="Max sequence length (a manual cap; supersedes auto-sizing). When omitted, resolved as: " + "EVO2_MAX_SEQ_LEN env var > auto-sized from the prompt token lengths (longest sampled prompt " + "+ --max-new-tokens). The dynamic context is CUDA-graph-pinned and cannot grow once set.", + ) + ap.add_argument( + "--max-seq-length-num-prompts", + type=int, + default=_DEFAULT_AUTO_MAX_SEQ_LENGTH_NUM_PROMPTS, + help="When --max-seq-length is auto (omitted), size the context from the longest of the first " + f"N prompts (default {_DEFAULT_AUTO_MAX_SEQ_LENGTH_NUM_PROMPTS}; pass 0 to scan all prompts). A " + "longer prompt beyond the first N grows the context on demand (one-time rebuild + CUDA-graph " + "re-capture); set --max-seq-length to pin a fixed size and avoid regrows.", ) ap.add_argument( "--max-batch-size", @@ -1183,6 +1427,50 @@ def parse_args() -> argparse.Namespace: return ap.parse_args() +def _resolve_prompt_auto_max_seq_length( + components: Evo2InferenceComponents, + prompt_texts: List[str], + *, + max_new_tokens: int, + num_prompts: Optional[int] = None, +) -> int: + """Auto-size the engine's initial ``max_seq_length`` from prompt token lengths. + + Sizes the persistent dynamic context to cover the longest of the first ``num_prompts`` prompts + (``None`` or ``<= 0`` = all) plus the generation budget, using the engine tokenizer. Only the + sampled prompts are tokenized here. A prompt beyond the sample that needs more is NOT a failure: + :func:`_generate_native_dynamic` grows the context on demand (rebuild + CUDA-graph re-capture). + Scanning a small leading sample just keeps startup cheap on large files and usually picks the + final size in one shot. Sets and returns ``nd.max_seq_length``. + """ + nd = components.native_dynamic + tokenizer = components.tokenizer + scan_all = num_prompts is None or int(num_prompts) <= 0 + sample = prompt_texts if scan_all else prompt_texts[: int(num_prompts)] + auto_msl = max(_auto_max_seq_length_for(len(tokenizer.tokenize(text)), max_new_tokens) for text in sample) + nd.max_seq_length = auto_msl + if int(os.environ.get("RANK", "0")) == 0: + if scan_all or len(sample) >= len(prompt_texts): + logger.info( + "[evo2-native] auto-sized max_seq_length=%d from all %d prompt(s) " + "(longest + max_new_tokens=%d + headroom=%d)", + auto_msl, + len(prompt_texts), + max_new_tokens, + _AUTO_MAX_SEQ_LENGTH_HEADROOM, + ) + else: + logger.info( + "[evo2-native] auto-sized max_seq_length=%d from the first %d of %d prompt(s); a longer " + "later prompt will grow the context on demand (set --max-seq-length to pin a fixed size, " + "or --max-seq-length-num-prompts 0 to scan all prompts up front)", + auto_msl, + len(sample), + len(prompt_texts), + ) + return auto_msl + + def infer( prompts: List[Dict[str, str]], ckpt_dir: Path, @@ -1199,7 +1487,8 @@ def infer( output_file: Optional[Path] = None, mixed_precision_recipe: Optional[str] = None, vortex_style_fp8: bool = False, - max_seq_length: int = 8192, + max_seq_length: Optional[int] = None, + max_seq_length_num_prompts: int = _DEFAULT_AUTO_MAX_SEQ_LENGTH_NUM_PROMPTS, max_batch_size: int = 1, use_subquadratic_ops: bool = False, enable_chunked_prefill: bool = False, @@ -1228,7 +1517,10 @@ def infer( mixed_precision_recipe: Override mixed precision recipe. vortex_style_fp8: Use vortex-style FP8 (applies FP8 only to projection layers). Needed for FP8-sensitive checkpoints from original evo2 training (1b, 40b). - max_seq_length: Maximum sequence length. + max_seq_length: Manual sequence-length cap (supersedes auto-sizing; never grows). ``None`` + (default) auto-sizes the engine from the prompt token lengths and grows on demand. + max_seq_length_num_prompts: When auto-sizing, size from the longest of the first N prompts + (``<= 0`` = all). A longer later prompt grows the context on demand rather than erroring. max_batch_size: Maximum batch size for inference. The inference engine pre-allocates GPU memory proportional to this value. For large models, only 1 may fit. use_subquadratic_ops: Use fused subquadratic-ops kernels in the inference path. @@ -1261,6 +1553,19 @@ def infer( mem_after_setup_gb = torch.cuda.max_memory_allocated() / (1024**3) logger.info(f"[MEMORY] After model setup: peak={mem_after_setup_gb:.3f} GB") + # Auto-size the engine's sequence-length budget from the prompts unless a manual value was given. + # Manual --max-seq-length supersedes (setup stored it; this only runs in auto mode). We size from + # the longest of the first --max-seq-length-num-prompts prompts here so the budget reflects the + # whole run (not just the first batch); prompts beyond that sample are validated per-batch in + # _generate_native_dynamic, which fails loudly with the exact --max-seq-length to set. + if max_seq_length is None and prompts: + _resolve_prompt_auto_max_seq_length( + components, + [entry["prompt"] for entry in prompts], + max_new_tokens=max_new_tokens, + num_prompts=max_seq_length_num_prompts, + ) + all_records: List[Dict[str, Any]] = [] total_prompt_tokens = 0 total_completion_tokens = 0 @@ -1361,7 +1666,9 @@ def main() -> None: args = parse_args() # --- Resolve settings: CLI arg > env var > auto-detected default --- - max_seq_length = _resolve_int(args.max_seq_length, "EVO2_MAX_SEQ_LEN", _detect_max_seq_length(args.ckpt_dir)) + # Manual --max-seq-length (or EVO2_MAX_SEQ_LEN) supersedes; otherwise None => auto-size from the + # prompts in infer() (which is tighter than the GPU-memory heuristic for typical short prompts). + max_seq_length = _resolve_int(args.max_seq_length, "EVO2_MAX_SEQ_LEN", None) if args.prompt_file is not None: prompts = _read_prompts_jsonl(args.prompt_file) @@ -1384,6 +1691,7 @@ def main() -> None: mixed_precision_recipe=args.mixed_precision_recipe, vortex_style_fp8=args.vortex_style_fp8, max_seq_length=max_seq_length, + max_seq_length_num_prompts=args.max_seq_length_num_prompts, max_batch_size=args.max_batch_size, use_subquadratic_ops=args.use_subquadratic_ops, enable_chunked_prefill=args.enable_chunked_prefill, diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py index 13f6d4de65..ef29f3e5a9 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py @@ -832,3 +832,220 @@ def test_batch_generate_mbridge( assert all(mp >= 0.90 * ep for mp, ep in zip(match_percents, expected_matchpercents)), ( f"Expected at least 90% of {matchperc_print_expected=}, got {matchperc_print=}" ) + + +@pytest.mark.timeout(900) +@pytest.mark.slow +def test_batch_generate_mbridge_subquadratic_ops(sequences: list[str], tmp_path: Path): + """Second-half match accuracy through the dynamic engine with the fused subquadratic-ops kernels. + + Mirrors :func:`test_batch_generate_mbridge` (1b-bf16, greedy) but enables ``use_subquadratic_ops`` + so the b2b causal-conv1d prefill and fft/causal-conv1d FIR kernels are exercised end-to-end on the + native dynamic (CUDA-graphed) decode path. This gives accuracy coverage for the subquadratic-ops + path through the dynamic engine, not just the default conv path. It xfails on hardware where the + prebuilt subquadratic kernels fail their CUDA self-test (unsupported PTX/toolchain), matching the + other subquadratic tests in this recipe. + """ + from bionemo.evo2.models.megatron.hyena.subquadratic_safety import ensure_subquadratic_ops_supported + from bionemo.evo2.run.infer import generate, setup_inference_engine + + ckpt_name = "evo2/1b-8k-bf16:1.0" + expected_matchpercents = [96.8, 29.7, 76.6, 71.6] + + assert len(sequences) > 0 + try: + _ = determine_memory_requirement_and_skip_if_not_met( + ckpt_name, test_name="test_batch_generate_mbridge_subquadratic_ops" + ) + except KeyError: + gb_available = torch.cuda.mem_get_info()[0] / 1024**3 + if gb_available < 16: + pytest.skip(f"Insufficient GPU memory: {gb_available:.1f}GB available, need at least 16GB") + + # Skip-as-xfail when the prebuilt subquadratic kernels do not pass their CUDA self-test here. + try: + ensure_subquadratic_ops_supported(torch.cuda.current_device()) + except Exception as exc: + pytest.xfail(f"subquadratic_ops kernels unsupported on this device: {exc}") + + num_tokens_to_generate = 500 + with distributed_model_parallel_state(), torch.no_grad(): + nemo2_ckpt_path = load(ckpt_name) + mbridge_ckpt_dir = run_nemo2_to_mbridge( + nemo2_ckpt_dir=nemo2_ckpt_path, + tokenizer_path=DEFAULT_HF_TOKENIZER_MODEL_PATH_512, + mbridge_ckpt_dir=tmp_path / "mbridge_checkpoint", + model_size="evo2_1b_base", + seq_length=8192, + mixed_precision_recipe="bf16_mixed", + vortex_style_fp8=False, + ) + mbridge_ckpt_path = mbridge_ckpt_dir / "iter_0000001" + + seq_splits = [mid_point_split(seq=seq, num_tokens=num_tokens_to_generate, fraction=0.5) for seq in sequences] + prompts = [split[0] for split in seq_splits] + targets = [split[1] for split in seq_splits] + + # use_subquadratic_ops=True routes prefill/FIR through the fused subquadratic kernels. + components = setup_inference_engine( + ckpt_dir=mbridge_ckpt_path, + max_seq_length=8192, + max_batch_size=1, + tensor_parallel_size=1, + random_seed=42, + use_subquadratic_ops=True, + ) + results = generate( + components, + prompts=prompts, + max_new_tokens=num_tokens_to_generate, + temperature=1.0, + top_k=1, # Greedy for determinism + ) + + match_percents = [ + calculate_sequence_identity(target, (result.generated_text if result else "")) or 0.0 + for result, target in zip(results, targets) + ] + for i, mp in enumerate(match_percents): + logger.info( + f"{ckpt_name} subquadratic seq[{i}] identity: {mp:.1f}% expected: {expected_matchpercents[i]:.1f}%" + ) + + assert len(match_percents) == len(expected_matchpercents) + matchperc_print = [f"{mp:.1f}%" for mp in match_percents] + matchperc_print_expected = [f"{ep:.1f}%" for ep in expected_matchpercents] + assert all(mp >= 0.90 * ep for mp, ep in zip(match_percents, expected_matchpercents)), ( + f"Expected at least 90% of {matchperc_print_expected=}, got {matchperc_print=}" + ) + + +@pytest.mark.timeout(900) +@pytest.mark.slow +def test_native_dynamic_multi_batch_reuses_engine(tmp_path: Path): + """The dynamic engine serves many generate() batches through ONE persistent CUDA-graphed context. + + ``setup_inference_engine`` builds a single dynamic context and captures the per-layer decode CUDA + graphs once (warmup). This test drives several ``generate`` calls of differing prompt counts and + lengths through that one engine and asserts (a) no CUDA-graph argument mismatch / crash across + calls and (b) greedy determinism: re-running an earlier batch yields byte-identical output. Both + only hold if the persistent context and its captured graph are correctly reused across calls -- + i.e. it guards the regression where a fresh per-prompt context broke graph replay, and the + capture-on-first-real-prompt bug that corrupted the first generated sequence. + """ + from bionemo.evo2.run.infer import generate, setup_inference_engine + + ckpt_name = "evo2/1b-8k-bf16:1.0" + try: + _ = determine_memory_requirement_and_skip_if_not_met( + ckpt_name, test_name="test_native_dynamic_multi_batch_reuses_engine" + ) + except KeyError: + gb_available = torch.cuda.mem_get_info()[0] / 1024**3 + if gb_available < 16: + pytest.skip(f"Insufficient GPU memory: {gb_available:.1f}GB available, need at least 16GB") + + # Batches of differing sizes/lengths; batch_a is repeated last to check cross-call determinism. + batch_a = ["ACGTACGTACGTACGTACGT" * 4, "TTACGGGCATTACGGGCATT" * 3] + batch_b = ["ACGTACGTACGTACGTACGT" * 30] # a single, longer prompt routed through the same engine + + with distributed_model_parallel_state(), torch.no_grad(): + nemo2_ckpt_path = load(ckpt_name) + mbridge_ckpt_dir = run_nemo2_to_mbridge( + nemo2_ckpt_dir=nemo2_ckpt_path, + tokenizer_path=DEFAULT_HF_TOKENIZER_MODEL_PATH_512, + mbridge_ckpt_dir=tmp_path / "mbridge_checkpoint", + model_size="evo2_1b_base", + seq_length=8192, + mixed_precision_recipe="bf16_mixed", + vortex_style_fp8=False, + ) + components = setup_inference_engine( + ckpt_dir=mbridge_ckpt_dir / "iter_0000001", + max_seq_length=8192, + max_batch_size=2, + tensor_parallel_size=1, + random_seed=42, + ) + + def _generate_texts(prompts: list[str]) -> list[str]: + results = generate(components, prompts=prompts, max_new_tokens=30, temperature=1.0, top_k=1) + return [result.generated_text for result in results] + + out_a1 = _generate_texts(batch_a) + out_b = _generate_texts(batch_b) # a different batch through the same persistent engine + out_a2 = _generate_texts(batch_a) # repeat of the first batch + + assert len(out_a1) == 2 and len(out_b) == 1 and len(out_a2) == 2 + assert all(len(text) > 0 for text in out_a1 + out_b + out_a2), "a generate() batch produced 0 tokens" + assert out_a1 == out_a2, f"cross-call nondeterminism with the reused engine:\n{out_a1}\n{out_a2}" + + +@pytest.mark.timeout(900) +@pytest.mark.slow +def test_native_dynamic_auto_max_seq_length_and_grow(tmp_path: Path): + """Prompt-based auto ``max_seq_length`` that GROWS on demand for a later, larger prompt. + + With no manual ``max_seq_length`` the engine sizes its persistent (CUDA-graph-pinned) context to + the prompt it first sees — longest prompt + ``max_new_tokens`` + headroom — rather than a fixed + 8k / GPU-memory heuristic. A later, longer prompt does not fail: because mcore has no in-place + resize, the engine rebuilds the context at a larger size and re-captures the CUDA graphs once, + then keeps generating. A subsequent shorter prompt reuses the (now larger) context without + shrinking and reproduces the earlier output, proving the rebuild + re-capture stays correct. + This guards the auto-sizing and the grow-by-rebuild + graph-recapture path. + """ + from bionemo.evo2.run.infer import generate, setup_inference_engine + + ckpt_name = "evo2/1b-8k-bf16:1.0" + try: + _ = determine_memory_requirement_and_skip_if_not_met( + ckpt_name, test_name="test_native_dynamic_auto_max_seq_length_and_grow" + ) + except KeyError: + gb_available = torch.cuda.mem_get_info()[0] / 1024**3 + if gb_available < 16: + pytest.skip(f"Insufficient GPU memory: {gb_available:.1f}GB available, need at least 16GB") + + short_prompt = "ACGT" * 10 # ~40 tokens + long_prompt = "ACGT" * 200 # ~800 tokens -> forces a grow of the auto budget + max_new_tokens = 20 + + with distributed_model_parallel_state(), torch.no_grad(): + nemo2_ckpt_path = load(ckpt_name) + mbridge_ckpt_dir = run_nemo2_to_mbridge( + nemo2_ckpt_dir=nemo2_ckpt_path, + tokenizer_path=DEFAULT_HF_TOKENIZER_MODEL_PATH_512, + mbridge_ckpt_dir=tmp_path / "mbridge_checkpoint", + model_size="evo2_1b_base", + seq_length=8192, + mixed_precision_recipe="bf16_mixed", + vortex_style_fp8=False, + ) + # No max_seq_length => auto-size from prompts (and grow on demand). + components = setup_inference_engine( + ckpt_dir=mbridge_ckpt_dir / "iter_0000001", + max_batch_size=1, + tensor_parallel_size=1, + random_seed=42, + ) + nd = components.native_dynamic + assert nd.max_seq_length is None and nd.max_seq_length_is_auto + + r_short = generate(components, prompts=[short_prompt], max_new_tokens=max_new_tokens, temperature=1.0, top_k=1) + initial_msl = len(components.tokenizer.tokenize(short_prompt)) + max_new_tokens + 8 # headroom + assert nd.max_seq_length == initial_msl, (nd.max_seq_length, initial_msl) + assert r_short[0].generated_length > 0 + + # A larger prompt GROWS the context (rebuild + CUDA-graph re-capture), no error, still generates. + r_long = generate(components, prompts=[long_prompt], max_new_tokens=max_new_tokens, temperature=1.0, top_k=1) + grown_msl = nd.max_seq_length + assert grown_msl > initial_msl + assert grown_msl >= len(components.tokenizer.tokenize(long_prompt)) + max_new_tokens + 8 + assert r_long[0].generated_length > 0 + + # A later shorter prompt reuses the grown context (no shrink) and reproduces the earlier output. + r_short2 = generate( + components, prompts=[short_prompt], max_new_tokens=max_new_tokens, temperature=1.0, top_k=1 + ) + assert nd.max_seq_length == grown_msl + assert r_short2[0].generated_text == r_short[0].generated_text From 884b2f413c1a80c1d5da493d75c751ce1bb9c787 Mon Sep 17 00:00:00 2001 From: "John St. John" Date: Thu, 4 Jun 2026 17:35:23 +0000 Subject: [PATCH 06/10] Evo2 dynamic inference: vectorized chunked-prefill block-step + real fp8 inference Chunked prefill (Hyena): - step_fir/step_iir accept an L-token block and thread the FIR ring / real-pole IIR modal state in one vectorized pass (equivalent to looping the single-token step); L==1 keeps the bit-identical, CUDA-graphed decode path. - Fix step_iir block dtype crash: cast residues/D to fp32 (the recurrence runs in fp32 to match the persistent iir_state buffer; einsum needs matching dtypes). FP8 inference (was always bf16 at generation; the "fp8" tests only converted in fp8): - setup_inference_engine now runs inference at the chosen precision and, for full fp8 (fp8 on all TE linears), calls mcore prepare_model_for_fp8_inference so each linear pads the token dim to the fp8 alignment -> single-token decode no longer fails assert_dim_for_fp8_exec. No-op for bf16 and vortex-style fp8. Tests: - test_batch_generate_mbridge exercises bf16 / vortex fp8 / full fp8 at inference with the second-half accuracy readout (full fp8 gets its own golden values). - Add full-fp8 with/without chunked-prefill test; add a bf16 IIR block unit test (catches the dtype mismatch on CPU) plus FIR/IIR block==per-token-loop unit tests. Co-Authored-By: Claude Opus 4.8 (1M context) Signed-off-by: John St. John --- .../evo2/models/megatron/hyena/engine.py | 70 +++++++- .../evo2/models/megatron/hyena/hyena_utils.py | 76 +++++---- .../src/bionemo/evo2/run/infer.py | 15 ++ .../evo2/models/megatron/hyena/test_engine.py | 95 +++++++++++ .../tests/bionemo/evo2/run/test_infer.py | 155 +++++++++++++++++- .../tests/bionemo/evo2/test_evo2.py | 19 ++- 6 files changed, 383 insertions(+), 47 deletions(-) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py index 775c9a24f7..fc90a88a3a 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py @@ -196,6 +196,25 @@ def step_fir(*, u, fir_state, weight, bias=None, gated_bias=False, flip_filter=F fir_state = fir_state.to(torch.float32) bias = bias.to(torch.float32) if bias is not None else None + if u.dim() == 3: + # ---- Vectorized block step: one causal depthwise conv over ``[ring || u]``. ---- + # ``u`` is a multi-token chunked-prefill continuation of shape [B, L, D]; returns [B, L, D]. + # This threads the FIR ring exactly as looping the single-token recurrence (below) over the L + # tokens would, but in a single conv. ``weight`` (already sliced/flipped to ``cache_size + 1`` + # taps above) is the cross-correlation kernel, so conv position t computes ``h0*u_t + Σ ring*h`` + # with the ring supplying the left context that ``parallel_fir``'s zero padding lacks. Assumes a + # full ring (``cache_size == filter_length - 1``), which holds after the first prefill chunk. + B, L, D = u.shape # noqa: N806 + u_dl = u.transpose(1, 2) # [B, D, L] + padded = torch.cat([fir_state, u_dl], dim=-1) # [B, D, cache_size + L] + kernel = weight.transpose(0, 1).contiguous() # [D, 1, cache_size + 1] + y = F.conv1d(padded, kernel, groups=D) # [B, D, L] + if bias is not None: + y = y + (bias[None, :, None] * u_dl if gated_bias else bias[None, :, None]) + # Ring <- last cache_size positions of [ring || u]; copy_ keeps the dynamic-context alias. + fir_state.copy_(padded[..., -cache_size:]) + return y.transpose(1, 2).to(input_dtype), fir_state + h0, h = weight[..., -1], weight[..., :-1] y = h0 * u + torch.sum(fir_state * h, dim=-1) @@ -219,16 +238,49 @@ def step_fir(*, u, fir_state, weight, bias=None, gated_bias=False, flip_filter=F def step_iir(*, x2, x1, v, D, residues, poles, iir_state): # noqa: N803 - """Steps forward IIR filters in the architecture.""" - x1v = x1 * v - poles = torch.exp(poles) # poles arg contains log_poles - poles = poles[..., 0][None] # squeeze dummy seqlen dim and add dummy batch dim - residues = residues[None] # add dummy batch dim - # In-place recurrence on the persistent IIR state buffer. Same math as the - # reallocating update: ``iir_state = poles * iir_state + x1v[..., None]``. - iir_state.mul_(poles).add_(x1v[..., None]) + """Steps forward IIR filters in the architecture. - res_state = torch.sum(residues * iir_state, dim=-1) + Single-token (``x1``/``x2``/``v`` of shape ``[B, d]``): the original O(d) diagonal recurrence + ``iir_state = poles * iir_state + x1*v``; ``y = x2 * (Σ residues*iir_state + D*x1*v)``. + + Block (``[B, d, L]``, used for a multi-token chunked-prefill continuation): the same real diagonal + recurrence evaluated over all L tokens in one vectorized pass, advancing ``iir_state`` by L. This + equals looping the single-token step L times (the poles are real here — see ``get_logp``). Writing + ``x1v_t = x1_t*v_t`` and ``h₋₁ = iir_state``, the state is ``h_t,n = poleₙ^{t+1}·h₋₁,n + Σ_{k≤t} + poleₙ^{t-k}·x1v_k``, so ``Σₙ residueₙ·h_t = (x1v * g)_t + Σₙ residueₙ·poleₙ^{t+1}·h₋₁,n`` where the + modal impulse response ``g_m = Σₙ residueₙ·poleₙ^m`` gives the zero-state part as a causal conv. + """ + poles = torch.exp(poles) # poles arg contains log_poles + poles = poles.squeeze(-1) # [d, n] (drop the dummy seqlen dim; squeeze only removes a size-1 dim) + + if x1.dim() == 3: + # ---- Vectorized block step over L tokens (real poles; FFT-free). ---- + # The recurrence runs in fp32 (matching the persistent iir_state buffer); residues/D arrive in + # the activation dtype (e.g. bf16), so cast them. einsum requires matching operand dtypes, + # unlike the single-token ``residues * iir_state`` below which promotes implicitly. + x1v = (x1 * v).to(torch.float32) # [B, d, L] + residues = residues.to(torch.float32) + decay = D.to(torch.float32) + B, d, L = x1v.shape # noqa: N806 + steps = torch.arange(L, device=x1v.device, dtype=torch.float32) # [L] + # Modal impulse response g_m = Σ_n residue_n * pole_n^m, m = 0..L-1. + g = torch.einsum("dn,dnl->dl", residues, poles[..., None] ** steps) # [d, L] + # Zero-state response = causal conv of x1v with g (left-pad so output position t sees k<=t). + zs_res = F.conv1d(F.pad(x1v, (L - 1, 0)), g.flip(-1).unsqueeze(1), groups=d) # [B, d, L] + # Carried-state decay: Σ_n residue_n * pole_n^{t+1} * h₋₁,n. + carried = torch.einsum("bdn,dnl->bdl", residues * iir_state, poles[..., None] ** (steps + 1)) + y = x2 * (zs_res + carried + decay[None, :, None] * x1v) # [B, d, L] + # Advance state by L: h_{L-1},n = pole_n^L * h₋₁,n + Σ_k pole_n^{L-1-k} * x1v_k. + h_zs = torch.einsum("bdl,dnl->bdn", x1v, poles[..., None] ** (L - 1 - steps)) # [B, d, n] + iir_state.copy_((poles**L) * iir_state + h_zs) # in-place to keep the dynamic-context alias + return y, iir_state + + # ---- Single token (unchanged): in-place O(d) recurrence on the persistent IIR state buffer. ---- + x1v = x1 * v + poles_b = poles[None] # [1, d, n] + residues_b = residues[None] # [1, d, n] + iir_state.mul_(poles_b).add_(x1v[..., None]) + res_state = torch.sum(residues_b * iir_state, dim=-1) y = x2 * (res_state + D * x1v) return y, iir_state diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_utils.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_utils.py index b5c81369c3..3aa976aeb8 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_utils.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/hyena_utils.py @@ -1014,24 +1014,35 @@ def get_filter_state(filter_name): compute_state=inference_context is not None, ) # y = rearrange(y, "b d l -> b l d") + elif L == 1: + # Ordinary single-token decode: exact O(d) modal step (the CUDA-graphed path). x1/x2 stay + # swapped per the single-step convention. + y_t, iir_state = engine.step_iir( + x2=x1[:, :, 0], # swapped: step_iir's x2 receives x1 + x1=x2[:, :, 0], + v=v[:, :, 0], + D=bias, + residues=self.filter.R, + poles=poles, + iir_state=iir_state, + ) + update_filter_state("iir", state=iir_state) + return y_t.unsqueeze(-1).to(dtype=x1.dtype) # [B, d, 1] else: - # Decode path: handle arbitrary batch size - # Input shapes: [b, d, l] where l=1 during decode - x1 = rearrange(x1, "b d l -> (b l) d") - x2 = rearrange(x2, "b d l -> (b l) d") - v = rearrange(v, "b d l -> (b l) d") - x1, x2 = x2, x1 # TODO: figure why it is swapped + # Multi-token chunked-prefill continuation: one vectorized block step threads the IIR modal + # state over the L tokens (equivalent to looping the single-step path; eager, not graphed). + # step_iir's block path returns [B, d, L] directly, so skip the [b l d -> b d l] rearrange. y, iir_state = engine.step_iir( - x2=x2, - x1=x1, + x2=x1, # swapped: step_iir's x2 receives x1 + x1=x2, v=v, - D=bias, # torch.Size([4096]) - residues=self.filter.R, # torch.Size([4096, 16]) - poles=poles, # torch.Size([4096, 16, 1]) + D=bias, + residues=self.filter.R, + poles=poles, iir_state=iir_state, ) - y = rearrange(y, "b d -> b 1 d") - y = y.to(dtype=x1.dtype) + update_filter_state("iir", state=iir_state) + return y.to(dtype=x1.dtype) # [B, d, L] update_filter_state("iir", state=iir_state) return rearrange(y, "b l d -> b d l") # b l d @@ -1071,10 +1082,21 @@ def get_filter_state(filter_name): ) y = rearrange(y, "b d l -> b l d") y = y * x1 + elif L == 1: + # Ordinary single-token decode: exact single-step inner FIR (the CUDA-graphed path). + y_t, fir_state = engine.step_fir( + u=u[:, 0], + fir_state=fir_state, + weight=h, + bias=bias, + gated_bias=self.kernel_size >= 128, # aka: only for medium filter + flip_filter=self.kernel_size >= 128, # aka: only for medium filter + ) + y = (x1[:, 0] * y_t).unsqueeze(1) # [B, 1, d] else: - u = rearrange(u, "b 1 d -> b d") - x1 = rearrange(x1, "b 1 d -> b d") - y, fir_state = engine.step_fir( + # Multi-token chunked-prefill continuation: one vectorized block step threads the inner FIR + # ring over the L tokens (equivalent to looping the single-step path; eager, not graphed). + y_blk, fir_state = engine.step_fir( u=u, fir_state=fir_state, weight=h, @@ -1082,8 +1104,7 @@ def get_filter_state(filter_name): gated_bias=self.kernel_size >= 128, # aka: only for medium filter flip_filter=self.kernel_size >= 128, # aka: only for medium filter ) - y = x1 * y - y = rearrange(y, "b d -> b 1 d") + y = x1 * y_blk # [B, L, d] update_filter_state("inner_fir", state=fir_state) return rearrange(y, "b l d -> b d l") # b l d @@ -1720,17 +1741,16 @@ def get_filter_state(filter_name): compute_state=inference_context is not None, use_subquadratic_ops=self.use_subquadratic_ops, ) + elif L == 1: + # Ordinary single-token decode: the exact O(D) single-step recurrence (this is the path + # the per-layer CUDA decode graph captures, so it must stay bit-identical). + z_t, fir_state = engine.step_fir(u=u[:, 0], fir_state=fir_state, weight=weight, bias=None) + z_pre = z_t.unsqueeze(-1) # [B, D, 1] else: - if len(u.shape) > 2: - u = u[:, -1] - - z_pre, fir_state = engine.step_fir( - u=u, - fir_state=fir_state, - weight=weight, - bias=None, - ) - z_pre = rearrange(z_pre, "b d -> b d 1") + # Multi-token chunked-prefill continuation: one vectorized block step threads the FIR ring + # over the L tokens (equivalent to looping the single-step path; runs eagerly, not graphed). + z_blk, fir_state = engine.step_fir(u=u, fir_state=fir_state, weight=weight, bias=None) + z_pre = z_blk.transpose(1, 2) # [B, L, D] -> [B, D, L] update_filter_state("fir", state=fir_state) return z_pre diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py index 13cda85044..1a3ed89de3 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py @@ -616,6 +616,21 @@ def setup_inference_engine( ) logger.info("Weights loaded successfully") + # FP8 TE GEMMs require the token (leading) dim to be a multiple of 8/16, but the dynamic engine + # decodes one token per request -> a [1, hidden] input fails TE's assert_dim_for_fp8_exec. When the + # precision recipe enables fp8 across ALL TE linears (e.g. "bf16_with_fp8_current_scaling_mixed"), + # wrap each one so it pads the token dimension up to the fp8 alignment and unpads the output + # (mcore's Fp8Padding/Fp8Unpadding). The wrapper is a no-op outside an active fp8 autocast, so bf16 + # layers are unaffected. This must run before CUDA-graph capture (the warmup) so the captured decode + # graph includes the padding. The vortex-style path uses a bf16 recipe (only its dense_projection is + # fp8, via te_compat's own padding linear), so getattr(mp_config, "fp8") is falsy there and we do not + # double-wrap it. + if getattr(mp_config, "fp8", None): + from megatron.core.fp8_utils import prepare_model_for_fp8_inference + + logger.info("FP8 recipe active: padding all TE linear layers for fp8 inference (token alignment)") + prepare_model_for_fp8_inference(raw_model) + # Wrap with Float16Module model = Float16Module(model_provider, raw_model) diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_engine.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_engine.py index b5701d2ddc..b3e8fe1ad8 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_engine.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_engine.py @@ -125,3 +125,98 @@ def test_parallel_fir_short_cuda_path_matches_torch_depthwise_conv1d(use_subquad torch.testing.assert_close(actual, expected, rtol=1e-5, atol=1e-5) torch.testing.assert_close(state, u_bdl[..., -(kernel_size - 1) :]) + + +@pytest.mark.parametrize("flip_filter", [False, True], ids=["noflip", "flip"]) +@pytest.mark.parametrize("gated_bias", [False, True], ids=["plainbias", "gatedbias"]) +def test_step_fir_block_matches_per_token_loop(flip_filter, gated_bias): + """The vectorized block step_fir (multi-token chunk) equals looping the single-token step_fir. + + Guards the chunked-prefill FIR fast path: a [B, L, D] block must thread the FIR ring identically + to stepping the L tokens one at a time (the proven decode primitive), so block and loop agree on + both the per-position output and the final ring state. + """ + torch.manual_seed(0) + batch, channels, kernel_size, seq_len = 2, 8, 5, 7 # ring (cache) size = kernel_size - 1 + weight = torch.randn(channels, 1, kernel_size) + bias = torch.randn(channels) + u = torch.randn(batch, seq_len, channels) + ring0 = torch.randn(batch, channels, kernel_size - 1) + + ring = ring0.clone() + ys = [] + for t in range(seq_len): + y_t, ring = engine.step_fir( + u=u[:, t].clone(), + fir_state=ring, + weight=weight.clone(), + bias=bias, + gated_bias=gated_bias, + flip_filter=flip_filter, + ) + ys.append(y_t) + y_loop = torch.stack(ys, dim=1) # [B, L, D] + + ring_block = ring0.clone() + y_block, ring_block = engine.step_fir( + u=u.clone(), + fir_state=ring_block, + weight=weight.clone(), + bias=bias, + gated_bias=gated_bias, + flip_filter=flip_filter, + ) + + torch.testing.assert_close(y_block, y_loop, rtol=1e-4, atol=1e-5) + torch.testing.assert_close(ring_block, ring, rtol=1e-4, atol=1e-5) + + +@pytest.mark.parametrize("act_dtype", [torch.float32, torch.bfloat16], ids=["fp32", "bf16"]) +def test_step_iir_block_matches_per_token_loop(act_dtype): + """The vectorized block step_iir (multi-token chunk) equals looping the single-token step_iir. + + Guards the chunked-prefill IIR fast path: a [B, d, L] block must thread the (real-pole) modal + state identically to stepping the L tokens one at a time, agreeing on both output and final state. + The bf16 case mirrors real inference (bf16 activations + residues/D, fp32 state + log-poles) and + guards the einsum dtype-mismatch a fp32-only test misses (the recurrence must run in fp32). + """ + torch.manual_seed(0) + batch, channels, order, seq_len = 2, 8, 4, 7 + log_poles = -(torch.rand(channels, order, 1) * 2.0 + 0.02) # fp32; exp(.) gives real stable poles in (0, 1) + # Activations + residues/D arrive in the activation dtype at inference; the IIR state stays fp32. + residues = torch.randn(channels, order).to(act_dtype) + decay_bias = torch.randn(channels).to(act_dtype) + x1 = torch.randn(batch, channels, seq_len).to(act_dtype) + x2 = torch.randn(batch, channels, seq_len).to(act_dtype) + v = torch.randn(batch, channels, seq_len).to(act_dtype) + state0 = torch.randn(batch, channels, order) # fp32 persistent state + + state = state0.clone() + ys = [] + for t in range(seq_len): + y_t, state = engine.step_iir( + x2=x2[:, :, t].clone(), + x1=x1[:, :, t].clone(), + v=v[:, :, t].clone(), + D=decay_bias, + residues=residues.clone(), + poles=log_poles.clone(), + iir_state=state, + ) + ys.append(y_t) + y_loop = torch.stack(ys, dim=-1) # [B, d, L] + + state_block = state0.clone() + y_block, state_block = engine.step_iir( + x2=x2.clone(), + x1=x1.clone(), + v=v.clone(), + D=decay_bias, + residues=residues.clone(), + poles=log_poles.clone(), + iir_state=state_block, + ) + + rtol, atol = (2e-2, 2e-2) if act_dtype == torch.bfloat16 else (1e-4, 1e-4) + torch.testing.assert_close(y_block, y_loop, rtol=rtol, atol=atol) + torch.testing.assert_close(state_block, state, rtol=rtol, atol=atol) diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py index d11682b0b3..09209750fb 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py @@ -50,7 +50,7 @@ from bionemo.evo2.utils.checkpoint.nemo2_to_mbridge import run_nemo2_to_mbridge from bionemo.evo2.utils.checkpoint.savanna_to_mbridge import savanna_to_mbridge -from ..utils import find_free_network_port +from ..utils import check_fp8_support, find_free_network_port # Capture environment at import time (consistent with test_predict.py) @@ -299,6 +299,7 @@ def run_infer_subprocess( seed: int = 42, use_subquadratic_ops: bool = False, max_seq_length: int | None = None, + block_size_tokens: int | None = None, return_log_probs: bool = False, extra_args: list[str] | None = None, ): @@ -317,6 +318,8 @@ def run_infer_subprocess( seed: Random seed for reproducibility use_subquadratic_ops: Pass --use-subquadratic-ops to the CLI. max_seq_length: If set, pass --max-seq-length (caps the per-context allocation). + block_size_tokens: If set, pass --inference-dynamic-batching-block-size (paged-KV block size). + The CLI default is 256; pin it explicitly when a test depends on the block boundary. return_log_probs: Pass --return-log-probs (logprobs included in the JSONL record). extra_args: Additional CLI arguments appended to the infer command. @@ -354,6 +357,8 @@ def run_infer_subprocess( cmd.append("--use-subquadratic-ops") if max_seq_length is not None: cmd.extend(["--max-seq-length", str(max_seq_length)]) + if block_size_tokens is not None: + cmd.extend(["--inference-dynamic-batching-block-size", str(block_size_tokens)]) if return_log_probs: cmd.append("--return-log-probs") if extra_args: @@ -1150,14 +1155,21 @@ def test_hyena_inference_context_different_sequence_lengths(): # prompt-shorter-than-the-medium-FIR-ring behavior. Greedy decoding (top_k=1) keeps the # assertions deterministic. -# A long DNA prompt (> block_size_tokens=256) that forces multi-block paged-KV prefill. +# Paged-KV block size for the multi-block prefill test below. It also happens to be the CLI/engine +# default, but the test pins it explicitly (passing --inference-dynamic-batching-block-size) so the +# "prompt spans more than one block" premise cannot be silently broken by a future change to the default. +KV_BLOCK_SIZE_TOKENS = 256 + +# A long DNA prompt (> KV_BLOCK_SIZE_TOKENS) that forces a multi-block paged-KV prefill. LONG_DNA_PROMPT = ( "GAATAGGAACAGCTCCGGTCTACAGCTCCCAGCGTGAGCGACGCAGAAGACGGTGATTTCTGCATTTCCATCTGAGGTACCGGGTTCATCTCACTAGG" "GAGTGCCAGACAGTGGGCGCAGGCCAGTGTGTGTGCGCACCGTGCGCGAGCCGAAGCAGGGCGAGGCATTGCCTCACCTGGGAAGCGCAAGGGGTCAG" "GGAGTTCCCTTTCCGAGTCAAAGAAAGGGGTGACGGACGCACCTGGAAAATCGGGTCACTCCCACCCGAATATTGCGCTTTTCAGACCGGCTTAAGAA" "ACGGCGCACCACGAGACTATATCCCACAC" ) -assert len(LONG_DNA_PROMPT) > 256, "LONG_DNA_PROMPT must exceed block_size_tokens=256 to cover >1 KV block" +assert len(LONG_DNA_PROMPT) > KV_BLOCK_SIZE_TOKENS, ( + f"LONG_DNA_PROMPT must exceed block_size_tokens={KV_BLOCK_SIZE_TOKENS} to cover >1 KV block" +) DNA_BASES = set("ACGTacgtNn") @@ -1187,16 +1199,22 @@ def test_native_dynamic_runs(mbridge_checkpoint_path, tmp_path): def test_native_dynamic_full_prefill_multi_block(mbridge_checkpoint_path, tmp_path): - """A prompt longer than block_size_tokens (256) prefills as one multi-block request. + """A prompt longer than the paged-KV block size prefills as one multi-block request. - Without --enable-chunked-prefill, the whole prompt is enqueued as one prefill chunk that - uses multiple 256-token KV blocks. The first forward processes all prompt tokens, and - last_token_logits selects the true final position before decode begins. + The block size is pinned explicitly (``--inference-dynamic-batching-block-size``) and the prompt + exceeds it, so with no ``--enable-chunked-prefill`` the whole prompt is enqueued as a single + prefill chunk whose KV spans ``ceil(n_prompt / block_size) >= 2`` paged blocks. The first forward + processes all prompt tokens, and last_token_logits selects the true final position before decode. + Pinning the block size (rather than relying on the default) is what makes this a multi-block test. """ if torch.cuda.device_count() < 1: pytest.skip("Native dynamic-engine test requires a GPU") + block_size_tokens = KV_BLOCK_SIZE_TOKENS n_prompt_tokens = len(LONG_DNA_PROMPT) - assert n_prompt_tokens > 256 + assert n_prompt_tokens > block_size_tokens, ( + f"LONG_DNA_PROMPT ({n_prompt_tokens} tokens) must exceed block_size_tokens={block_size_tokens} " + "to span more than one KV block" + ) record = run_infer_subprocess( mbridge_checkpoint_path, prompt=LONG_DNA_PROMPT, @@ -1206,8 +1224,9 @@ def test_native_dynamic_full_prefill_multi_block(mbridge_checkpoint_path, tmp_pa top_k=1, seed=42, max_seq_length=512, + block_size_tokens=block_size_tokens, ) - # The whole prompt must have been prefilled (multi-block) and 20 tokens generated. + # The whole prompt must have been prefilled (KV spanning >1 block) and 20 tokens generated. assert record["usage"]["prompt_tokens"] == n_prompt_tokens, ( f"prompt_tokens {record['usage']['prompt_tokens']} != {n_prompt_tokens}; multi-block " "prefill did not enqueue the full prompt" @@ -1243,6 +1262,124 @@ def test_native_dynamic_chunked_prefill_cli_multi_chunk(mbridge_checkpoint_path, assert _is_dna_completion(record["completion"]), f"non-DNA completion: {record['completion']!r}" +def test_native_dynamic_chunked_prefill_matches_full_prefill(mbridge_checkpoint_path, tmp_path): + """Chunked prefill yields the same greedy continuation as single-shot (full) prefill. + + This is the prefix-invariance idea (same prompt -> same completion two ways) applied to chunked + prefill: prefilling the whole prompt in one forward vs splitting it across multiple prefill + forwards (``--enable-chunked-prefill`` with a per-step token budget below the prompt length) must + produce identical tokens under greedy decoding, since chunked prefill is only a memory-bounded way + to compute the same prefill. The existing chunked-prefill test only checks it runs and emits DNA; + this one pins the equivalence to full prefill. It guards the Hyena chunked-prefill fix: the FIR/IIR + recurrent state is threaded across chunks by stepping each chunk's tokens through step_fir/step_iir + (hyena_utils.ParallelCausalDepthwiseConv1dWithState.forward / forward_long / forward_medium); before + that fix, chunk 1+ was misclassified as a single decode step and the output degenerated. + """ + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + + n_prompt_tokens = len(LONG_DNA_PROMPT) + chunk_max_tokens = 128 + # Force at least two prefill chunks with a non-trivial final chunk (>1 token). + assert n_prompt_tokens > 2 * chunk_max_tokens, ( + f"LONG_DNA_PROMPT ({n_prompt_tokens} tokens) must exceed 2*chunk_max_tokens={2 * chunk_max_tokens} " + "to exercise multiple prefill chunks" + ) + + full = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=LONG_DNA_PROMPT, + output_file=tmp_path / "full_prefill.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, # greedy -> deterministic + seed=42, + max_seq_length=512, + ) + chunked = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=LONG_DNA_PROMPT, + output_file=tmp_path / "chunked_prefill.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + extra_args=[ + "--enable-chunked-prefill", + "--inference-dynamic-batching-max-tokens", + str(chunk_max_tokens), + ], + ) + + # Both prefilled the full prompt; chunked must reproduce the single-shot greedy continuation. + assert full["usage"]["prompt_tokens"] == n_prompt_tokens == chunked["usage"]["prompt_tokens"] + assert full["usage"]["completion_tokens"] == 20 == chunked["usage"]["completion_tokens"] + assert _is_dna_completion(full["completion"]), f"non-DNA full-prefill completion: {full['completion']!r}" + assert chunked["completion"] == full["completion"], ( + "chunked prefill diverged from full prefill:\n" + f" full ={full['completion']!r}\n" + f" chunked={chunked['completion']!r}" + ) + + +def test_native_dynamic_full_fp8_runs_with_and_without_chunked_prefill(mbridge_checkpoint_path, tmp_path): + """Full fp8 inference (fp8 on every TE linear) runs both with full and with chunked prefill. + + Confirms the fp8 token-padding path (``prepare_model_for_fp8_inference``, applied in + ``setup_inference_engine`` when the recipe turns on fp8) coexists with (a) the multi-block / + chunked-prefill Hyena block-step and (b) the CUDA-graphed single-token decode. Greedy full vs + chunked fp8 completions need NOT be bit-identical: current-scaling fp8 derives each GEMM's scale + from its own activation amax, which differs between a whole-prompt prefill and per-chunk prefills. + So this pins that BOTH configurations run and emit a valid DNA completion of the requested length + (not that they match) -- the bf16 equivalence above already pins the exact full==chunked behavior. + """ + if torch.cuda.device_count() < 1: + pytest.skip("Native dynamic-engine test requires a GPU") + is_fp8_supported, compute_capability, device_info = check_fp8_support(torch.cuda.current_device()) + if not is_fp8_supported: + pytest.skip(f"FP8 not supported on {device_info} ({compute_capability})") + + n_prompt_tokens = len(LONG_DNA_PROMPT) + chunk_max_tokens = 128 + assert n_prompt_tokens > 2 * chunk_max_tokens, ( + f"LONG_DNA_PROMPT ({n_prompt_tokens} tokens) must exceed 2*chunk_max_tokens={2 * chunk_max_tokens}" + ) + fp8_args = ["--mixed-precision-recipe", "bf16_with_fp8_current_scaling_mixed"] + + full = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=LONG_DNA_PROMPT, + output_file=tmp_path / "fp8_full_prefill.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, # greedy + seed=42, + max_seq_length=512, + extra_args=fp8_args, + ) + chunked = run_infer_subprocess( + mbridge_checkpoint_path, + prompt=LONG_DNA_PROMPT, + output_file=tmp_path / "fp8_chunked_prefill.jsonl", + max_new_tokens=20, + temperature=1.0, + top_k=1, + seed=42, + max_seq_length=512, + extra_args=fp8_args + + ["--enable-chunked-prefill", "--inference-dynamic-batching-max-tokens", str(chunk_max_tokens)], + ) + for label, rec in (("full", full), ("chunked", chunked)): + assert rec["usage"]["prompt_tokens"] == n_prompt_tokens, ( + f"{label} fp8 prefill enqueued {rec['usage']['prompt_tokens']} != {n_prompt_tokens}" + ) + assert rec["usage"]["completion_tokens"] == 20, ( + f"{label} fp8 generated {rec['usage']['completion_tokens']} != 20 tokens" + ) + assert _is_dna_completion(rec["completion"]), f"non-DNA {label} fp8 completion: {rec['completion']!r}" + + def test_native_dynamic_single_token_decode(mbridge_checkpoint_path, tmp_path): """A single decode step (max_new_tokens=1) produces exactly one token after prefill.""" if torch.cuda.device_count() < 1: diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py index ef29f3e5a9..71586f418b 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py @@ -713,7 +713,13 @@ def test_batch_generate_coding_sequences( id="1b-bf16_bf16", marks=pytest.mark.skipif(bool(os.environ.get("CI")), reason="Skip in CI due to slow speed"), ), - pytest.param("evo2/1b-8k-bf16:1.0", [96.8, 29.7, 76.6, 71.6], True, id="1b-bf16_fp8"), + # Full fp8 (fp8 on ALL TE linears) is exercised AT INFERENCE on the bf16 checkpoint. It runs + # via mcore's fp8 token-padding (prepare_model_for_fp8_inference in setup_inference_engine) but + # quantizing every linear degrades the highly-conserved seq[0] (~96.6% in bf16 -> ~82.8%); the + # other sequences are essentially unchanged. These golden values reflect full-fp8 inference. + pytest.param("evo2/1b-8k-bf16:1.0", [82.8, 32.4, 73.0, 71.2], True, id="1b-bf16_fp8"), + # The 1b-8k checkpoint is fp8-sensitive and only works as vortex-style fp8 (bf16 recipe + fp8 on + # just the hyena dense_projection), which preserves accuracy at inference (~96.4% on seq[0]). pytest.param( "evo2/1b-8k:1.0", [96.8, 29.7, 76.6, 71.6], @@ -773,6 +779,13 @@ def test_batch_generate_mbridge( pytest.skip(f"Skipping {ckpt_name} - FP8 not supported on {device_info} ({compute_capability})") num_tokens_to_generate = 500 # Match original test + # Precision modes covered by the (ckpt, fp8) params, run at inference (not just at conversion): + # * bf16 -> bf16_mixed, no fp8 (id "1b-bf16_bf16") + # * full fp8 -> fp8 on ALL TE linears (id "1b-bf16_fp8", bf16 checkpoint) + # * vortex-style fp8 -> bf16 recipe + fp8 only on the (id "1b_fp8", the fp8-required 1b-8k ckpt) + # hyena dense_projection + # The 1b-8k checkpoint is fp8-sensitive and only works as vortex-style fp8 (a bf16 recipe with a + # very small number of fp8 layers); the bf16 checkpoint tolerates full fp8. vortex_style_fp8 = ckpt_name == "evo2/1b-8k:1.0" and fp8 mixed_precision_recipe = "bf16_with_fp8_current_scaling_mixed" if fp8 and not vortex_style_fp8 else "bf16_mixed" @@ -797,12 +810,16 @@ def test_batch_generate_mbridge( # Setup the public Evo2 generation endpoint. # max_batch_size=1 keeps this memory-heavy test bounded. + # Run inference at the SAME precision the checkpoint was converted with (the prior version + # always inferred in bf16, so the fp8 ids never actually exercised fp8 at generation time). components = setup_inference_engine( ckpt_dir=mbridge_ckpt_path, max_seq_length=8192, max_batch_size=1, # 1 because this test takes more memory. tensor_parallel_size=1, random_seed=42, + mixed_precision_recipe=mixed_precision_recipe, + vortex_style_fp8=vortex_style_fp8, ) # Generate all sequences through the public endpoint. From 9b5992f4648d1764226824c6250705f8642e0f16 Mon Sep 17 00:00:00 2001 From: "John St. John" Date: Thu, 4 Jun 2026 13:06:06 -0700 Subject: [PATCH 07/10] PR feedback Signed-off-by: John St. John --- .../evo2/models/megatron/hyena/engine.py | 11 ++-- .../megatron/hyena/subquadratic_safety.py | 7 ++- .../src/bionemo/evo2/run/infer.py | 30 +++++++++-- .../tests/bionemo/evo2/run/test_infer.py | 51 +++++++++++-------- 4 files changed, 67 insertions(+), 32 deletions(-) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py index fc90a88a3a..db6c187f06 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/engine.py @@ -25,11 +25,9 @@ try: from subquadratic_ops_torch.causal_conv1d import causal_conv1d as _subq_causal_conv1d from subquadratic_ops_torch.fft_causal_conv1d import fft_causal_conv1d as _subq_fft_causal_conv1d - from subquadratic_ops_torch.rearrange import rearrange as _subq_rearrange except ImportError as _subq_import_error: _subq_causal_conv1d = None _subq_fft_causal_conv1d = None - _subq_rearrange = None _subq_error_msg = f"subquadratic_ops_torch not available: {_subq_import_error}" @@ -84,10 +82,11 @@ def parallel_fir( if use_subquadratic_ops and _subq_fft_causal_conv1d is None: raise ImportError(_subq_error_msg) - if use_subquadratic_ops: - u = _subq_rearrange(u.transpose(0, 1), bhl_to_lbh=False) - else: - u = rearrange(u, "b l d -> b d l") + # Layout to [B, D, L]. We deliberately do NOT use the subquadratic-ops rearrange kernel here even + # when use_subquadratic_ops is set: it is a training-tuned custom kernel and is slower than a plain + # einops/transpose for this inference layout op. The subq win is in the compute kernels below + # (fft_causal_conv1d / causal_conv1d), not in the rearrange. + u = rearrange(u, "b l d -> b d l") if fir_length >= 128: if use_subquadratic_ops: diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py index 7ef53c901a..2d623e1b0d 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py @@ -150,16 +150,19 @@ def ensure_subquadratic_b2b_causal_conv1d_supported(device_index: int | None = N actual = subq_b2b_causal_conv1d(x, proj_weight, mixer_weight, bias) + # subquadratic_ops_torch.b2b_causal_conv1d uses the weight[-1] == current-tap convention + # (same as its causal_conv1d), so the reference convs must NOT flip the weights. Flipping + # them produces a spurious ~0.6 relative mismatch that wrongly trips the self-test. projected = F.conv1d( F.pad(x, (proj_kernel_size - 1, 0)), - proj_weight.flip(-1).unsqueeze(1), + proj_weight.unsqueeze(1), groups=3 * hidden_size, ) x1, x2, v = projected[:, ::3], projected[:, 1::3], projected[:, 2::3] z = x2 * v mixed = F.conv1d( F.pad(z, (mixer_kernel_size - 1, 0)), - mixer_weight.flip(-1).unsqueeze(1), + mixer_weight.unsqueeze(1), groups=hidden_size, ) expected = x1 * (mixed + bias[None, :, None] * z) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py index 1a3ed89de3..774ca45e38 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py @@ -380,20 +380,27 @@ def _setup_native_dynamic_components( ) -def _configure_native_dynamic_cuda_graphs(model_provider: Any, *, rank: int) -> bool: +def _configure_native_dynamic_cuda_graphs(model_provider: Any, *, rank: int, cuda_graph_impl: str = "local") -> bool: """Enable mcore local CUDA graphs for Evo2 dynamic inference when supported. This mirrors Megatron's ``cuda_graph_impl=local`` setup, but applies it directly to the provider loaded from the checkpoint because this recipe does not use Megatron's global arg parser. Empty ``cuda_graph_scope`` means per-layer local graph capture for every graphable layer; Evo2's HyenaLayer follows the same convention as mcore's MambaLayer. + + ``cuda_graph_impl="none"`` disables graph capture entirely (decode runs eager) -- useful for + debugging and for tests that need an un-graphed reference to compare against. """ + if cuda_graph_impl == "none": + if rank == 0: + logger.info("[evo2-native-cg] CUDA graphs disabled (cuda_graph_impl='none'); decode runs eager") + return False if not hasattr(model_provider, "cuda_graph_impl"): if rank == 0: logger.warning("[evo2-native-cg] model provider has no cuda_graph_impl; CUDA graphs disabled") return False - model_provider.cuda_graph_impl = "local" + model_provider.cuda_graph_impl = cuda_graph_impl model_provider.cuda_graph_scope = [] os.environ.setdefault("NCCL_GRAPH_REGISTER", "0") if rank == 0: @@ -454,6 +461,7 @@ def setup_inference_engine( vortex_style_fp8: bool = False, random_seed: int = 1234, use_subquadratic_ops: bool = False, + cuda_graph_impl: str = "local", ) -> Evo2InferenceComponents: """Setup the Evo2 native dynamic-inference engine and related components. @@ -481,6 +489,8 @@ def setup_inference_engine( use_subquadratic_ops: Use fused subquadratic-ops kernels (b2b causal conv1d in prefill, fft_causal_conv1d / causal_conv1d in parallel_fir). + cuda_graph_impl: ``"local"`` (default) captures mcore per-layer CUDA graphs for decode; + ``"none"`` disables graph capture (eager decode), mainly for debugging / reference runs. Returns: Evo2InferenceComponents containing all inference components. @@ -519,7 +529,9 @@ def setup_inference_engine( # static-batching, so flash_decode (which asserts static batching, attention.py) MUST be off. model_provider.flash_decode = False model_provider.use_subquadratic_ops = use_subquadratic_ops - cuda_graphs_enabled = _configure_native_dynamic_cuda_graphs(model_provider, rank=int(os.environ.get("RANK", "0"))) + cuda_graphs_enabled = _configure_native_dynamic_cuda_graphs( + model_provider, rank=int(os.environ.get("RANK", "0")), cuda_graph_impl=cuda_graph_impl + ) if cuda_graphs_enabled and getattr(model_provider, "recompute_granularity", None): logger.info("Disabling activation recompute for inference CUDA graphs") model_provider.recompute_granularity = None @@ -1419,6 +1431,13 @@ def parse_args() -> argparse.Namespace: "fft_causal_conv1d / causal_conv1d in parallel_fir). Speeds up prompt processing " "but has no effect on per-token decode throughput.", ) + ap.add_argument( + "--cuda-graph-impl", + choices=["none", "local"], + default="local", + help="CUDA-graph mode for dynamic decode: 'local' (mcore per-layer graphs, default) or 'none' " + "(eager decode, no graph capture). 'none' is mainly for debugging / un-graphed reference runs.", + ) ap.add_argument( "--enable-chunked-prefill", action="store_true", @@ -1506,6 +1525,7 @@ def infer( max_seq_length_num_prompts: int = _DEFAULT_AUTO_MAX_SEQ_LENGTH_NUM_PROMPTS, max_batch_size: int = 1, use_subquadratic_ops: bool = False, + cuda_graph_impl: str = "local", enable_chunked_prefill: bool = False, inference_dynamic_batching_max_tokens: Optional[int] = None, inference_dynamic_batching_block_size: int = 256, @@ -1539,6 +1559,8 @@ def infer( max_batch_size: Maximum batch size for inference. The inference engine pre-allocates GPU memory proportional to this value. For large models, only 1 may fit. use_subquadratic_ops: Use fused subquadratic-ops kernels in the inference path. + cuda_graph_impl: ``"local"`` (default) uses mcore per-layer decode CUDA graphs; ``"none"`` + runs decode eagerly (no graph capture) -- mainly for debugging / un-graphed reference runs. enable_chunked_prefill: Split prompts across multiple prefill forwards when needed. inference_dynamic_batching_max_tokens: Optional dynamic-context per-step token budget. inference_dynamic_batching_block_size: Paged-KV block size for dynamic inference. @@ -1564,6 +1586,7 @@ def infer( vortex_style_fp8=vortex_style_fp8, random_seed=random_seed, use_subquadratic_ops=use_subquadratic_ops, + cuda_graph_impl=cuda_graph_impl, ) mem_after_setup_gb = torch.cuda.max_memory_allocated() / (1024**3) logger.info(f"[MEMORY] After model setup: peak={mem_after_setup_gb:.3f} GB") @@ -1709,6 +1732,7 @@ def main() -> None: max_seq_length_num_prompts=args.max_seq_length_num_prompts, max_batch_size=args.max_batch_size, use_subquadratic_ops=args.use_subquadratic_ops, + cuda_graph_impl=args.cuda_graph_impl, enable_chunked_prefill=args.enable_chunked_prefill, inference_dynamic_batching_max_tokens=args.inference_dynamic_batching_max_tokens, inference_dynamic_batching_block_size=args.inference_dynamic_batching_block_size, diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py index 09209750fb..da1d9d9229 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py @@ -298,6 +298,7 @@ def run_infer_subprocess( top_k: int = 1, seed: int = 42, use_subquadratic_ops: bool = False, + cuda_graph_impl: str | None = None, max_seq_length: int | None = None, block_size_tokens: int | None = None, return_log_probs: bool = False, @@ -317,6 +318,8 @@ def run_infer_subprocess( top_k: Top-k sampling parameter (1 for greedy) seed: Random seed for reproducibility use_subquadratic_ops: Pass --use-subquadratic-ops to the CLI. + cuda_graph_impl: If set, pass --cuda-graph-impl ("local" = mcore per-layer decode graphs, + "none" = eager decode). Defaults to the CLI default ("local") when None. max_seq_length: If set, pass --max-seq-length (caps the per-context allocation). block_size_tokens: If set, pass --inference-dynamic-batching-block-size (paged-KV block size). The CLI default is 256; pin it explicitly when a test depends on the block boundary. @@ -355,6 +358,8 @@ def run_infer_subprocess( ] if use_subquadratic_ops: cmd.append("--use-subquadratic-ops") + if cuda_graph_impl is not None: + cmd.extend(["--cuda-graph-impl", str(cuda_graph_impl)]) if max_seq_length is not None: cmd.extend(["--max-seq-length", str(max_seq_length)]) if block_size_tokens is not None: @@ -677,44 +682,48 @@ def test_identical_prompts_should_be_identical(mbridge_checkpoint_path, tmp_path ) -def test_subquadratic_ops_matches_baseline(mbridge_checkpoint_path, tmp_path): - """Greedy generation with --use-subquadratic-ops must match the standard path. - - This is the end-to-end correctness check for the subq-ops inference path. - The subq path uses guarded subquadratic kernels. If the local CUDA/GPU - combination cannot run those kernels correctly, the guard raises before - invalid outputs can propagate. With greedy decoding (top_k=1) and the same - seed, supported subq kernels must produce identical output. +@pytest.mark.parametrize("cuda_graph_impl", ["none", "local"]) +@pytest.mark.parametrize("use_subquadratic_ops", [False, True]) +def test_subquadratic_ops_with_cuda_graph_matches_baseline( + mbridge_checkpoint_path, tmp_path, use_subquadratic_ops, cuda_graph_impl +): + """Every (subq-ops x CUDA-graph) combination matches the eager, non-subq baseline. + + The reference is the simplest path: standard kernels with CUDA graphs OFF (``cuda_graph_impl=none``). + Greedy decoding (top_k=1) + a fixed seed make generation deterministic, so each of the four + combinations of {standard, subq-ops} x {eager, local CUDA graphs} must produce byte-identical output. + This covers the otherwise-untested combination of fused subquadratic-ops prefill together with + CUDA-graphed decode. The subq path uses guarded kernels: if this GPU cannot run them, + ``run_infer_subprocess`` xfails (via the CUDA self-test guard) instead of producing invalid output. """ - output_baseline = tmp_path / "output_baseline.jsonl" - output_subq = tmp_path / "output_subq.jsonl" - - generated_baseline = run_infer_subprocess( + baseline = run_infer_subprocess( mbridge_checkpoint_path, prompt=PROMPT_1, - output_file=output_baseline, + output_file=tmp_path / "output_baseline.jsonl", max_new_tokens=20, temperature=1.0, top_k=1, seed=42, use_subquadratic_ops=False, + cuda_graph_impl="none", ) - - generated_subq = run_infer_subprocess( + variant = run_infer_subprocess( mbridge_checkpoint_path, prompt=PROMPT_1, - output_file=output_subq, + output_file=tmp_path / "output_variant.jsonl", max_new_tokens=20, temperature=1.0, top_k=1, seed=42, - use_subquadratic_ops=True, + use_subquadratic_ops=use_subquadratic_ops, + cuda_graph_impl=cuda_graph_impl, ) - assert len(generated_baseline) > 0, "Baseline generation produced empty output" - assert len(generated_subq) > 0, "Subq-ops generation produced empty output" - assert generated_baseline == generated_subq, ( - f"Subq-ops path diverged from baseline:\nBaseline: {generated_baseline}\nSubq-ops: {generated_subq}" + assert baseline["completion"], "Baseline generation produced empty output" + assert variant["completion"], "Variant generation produced empty output" + assert variant["completion"] == baseline["completion"], ( + f"subq_ops={use_subquadratic_ops}, cuda_graph_impl={cuda_graph_impl} diverged from the " + f"eager non-subq baseline:\n baseline={baseline['completion']!r}\n variant ={variant['completion']!r}" ) From 7823b2338e6c99d92113957f9c82767b11c36b65 Mon Sep 17 00:00:00 2001 From: John St John Date: Thu, 4 Jun 2026 13:49:08 -0700 Subject: [PATCH 08/10] add help message to subq safety about system driver issues Signed-off-by: John St John --- .../megatron/hyena/subquadratic_safety.py | 132 +++++++++++++++++- .../hyena/test_subquadratic_safety.py | 80 +++++++++++ 2 files changed, 209 insertions(+), 3 deletions(-) create mode 100644 bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_subquadratic_safety.py diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py index 2d623e1b0d..43e1266121 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/models/megatron/hyena/subquadratic_safety.py @@ -13,18 +13,143 @@ # See the License for the specific language governing permissions and # limitations under the License. +import warnings from functools import lru_cache import torch import torch.nn.functional as F # noqa: N812 +try: + import pynvml +except ImportError: # pragma: no cover - pynvml ships as a subquadratic_ops_torch dependency + pynvml = None + + +@lru_cache(maxsize=None) +def _host_driver_cuda_version() -> int | None: + """Max CUDA version the host NVIDIA driver supports, as an NVML int (e.g. 13020 for 13.2). + + This is the CUDA ceiling reported by ``nvidia-smi`` ("CUDA Version"). Returns None if it + cannot be determined (pynvml missing, or no driver visible inside the container). + """ + if pynvml is None: + return None + try: + pynvml.nvmlInit() + try: + return int(pynvml.nvmlSystemGetCudaDriverVersion()) + finally: + pynvml.nvmlShutdown() + except Exception: + return None + + +@lru_cache(maxsize=None) +def _host_driver_version() -> str | None: + """Host NVIDIA driver build string (e.g. '595.71.05'), or None if it cannot be determined.""" + if pynvml is None: + return None + try: + pynvml.nvmlInit() + try: + version = pynvml.nvmlSystemGetDriverVersion() + return version.decode() if isinstance(version, bytes) else version + finally: + pynvml.nvmlShutdown() + except Exception: + return None + + +@lru_cache(maxsize=None) +def _image_cuda_version() -> int | None: + """CUDA toolkit version this image/PyTorch build targets, as an NVML int (e.g. 13020 for 13.2). + + The prebuilt subquadratic_ops_torch kernels shipped in the image are compiled for this CUDA + version. Derived from ``torch.version.cuda`` ("the CUDA install in the image"). Returns None if + it cannot be parsed. + """ + cuda = torch.version.cuda + if cuda: + try: + major, _, minor = cuda.partition(".") + return int(major) * 1000 + (int(minor) if minor else 0) * 10 + except ValueError: + pass + try: + return int(torch._C._cuda_getCompiledVersion()) + except Exception: + return None + + +def _cuda_version_to_str(version: int | None) -> str: + """Format an NVML/CUDA integer version (e.g. 13020) as 'major.minor' (e.g. '13.2').""" + if version is None: + return "unknown" + return f"{version // 1000}.{(version % 1000) // 10}" + + +def _driver_image_cuda_diagnostic() -> str: + """Diagnose a host-driver vs image-CUDA mismatch and explain how to fix it. + + subquadratic_ops_torch ships *prebuilt* CUDA kernels (SASS cubins), not runtime-compiled PTX. + A host driver that only supports an older CUDA version than the image cannot load those cubins, + so the kernels silently fail to launch and return zeros/garbage -- frequently surfacing as a + misleading ``CUDA_ERROR_UNSUPPORTED_PTX_VERSION`` even though no PTX compilation is involved. + """ + driver_cuda = _host_driver_cuda_version() + image_cuda = _image_cuda_version() + driver_str = _cuda_version_to_str(driver_cuda) + image_str = _cuda_version_to_str(image_cuda) + summary = ( + f"Host NVIDIA driver {_host_driver_version() or 'unknown'} supports up to CUDA {driver_str}; " + f"the CUDA toolkit in this image is {image_str}." + ) + + if driver_cuda is not None and image_cuda is not None and driver_cuda < image_cuda: + return ( + f"{summary} ROOT CAUSE: the host driver is too old for this image. subquadratic_ops_torch " + f"ships prebuilt CUDA kernels compiled for CUDA {image_str}, and a driver that only supports " + f"CUDA {driver_str} cannot load them -- they then silently return zeros/garbage (often " + f"surfacing as the misleading 'CUDA_ERROR_UNSUPPORTED_PTX_VERSION', even though no runtime PTX " + f"compilation is involved). FIX: upgrade the HOST NVIDIA driver to one supporting CUDA " + f">= {image_str} (for CUDA 13.2 use driver r595 or newer). The driver lives on the HOST, not " + f"inside the container, so rebuilding or changing the image will NOT help; instead run on a " + f"host whose `nvidia-smi` 'CUDA Version' is >= {image_str}, or use an image whose CUDA is " + f"<= the host driver's CUDA." + ) + if driver_cuda is not None and image_cuda is not None: + return ( + f"{summary} The host driver supports CUDA {driver_str} >= image CUDA {image_str}, so a " + f"driver/toolkit version mismatch is unlikely to be the cause; verify this GPU's compute " + f"capability is among subquadratic_ops_torch's prebuilt architectures." + ) + return ( + f"{summary} Could not fully determine the driver and/or image CUDA versions to diagnose further " + f"-- check that the NVIDIA driver is visible inside the container and that pynvml is installed." + ) + + +def warn_if_host_driver_too_old() -> None: + """Warn (without raising) if the host driver is older than the image's CUDA toolkit. + + Advisory only -- the per-op CUDA self-tests below are the authoritative correctness gate (CUDA + minor-version compatibility means a slightly older driver can still work for some architectures). + This surfaces the most common root cause early, with an actionable message, since a too-old host + driver makes the prebuilt subquadratic_ops_torch kernels silently return invalid output. + """ + driver_cuda = _host_driver_cuda_version() + image_cuda = _image_cuda_version() + if driver_cuda is not None and image_cuda is not None and driver_cuda < image_cuda: + warnings.warn(f"[subquadratic_ops_torch] {_driver_image_cuda_diagnostic()}", stacklevel=2) + + def _raise_subquadratic_self_test_error(op_name: str, detail: str) -> None: raise RuntimeError( f"subquadratic_ops_torch.{op_name} failed a CUDA self-test ({detail}). " - "This often happens with CUDA_ERROR_UNSUPPORTED_PTX_VERSION or unsupported GPU/toolchain " - "combinations. Refusing to run this subquadratic kernel because it can otherwise return " - "invalid outputs without raising." + "This usually means the prebuilt subquadratic_ops_torch CUDA kernels could not be loaded or " + "launched on this GPU/driver, so they returned invalid output without raising. " + f"{_driver_image_cuda_diagnostic()}" ) @@ -44,6 +169,7 @@ def _assert_close_or_raise(op_name: str, actual: torch.Tensor, expected: torch.T @lru_cache(maxsize=None) def ensure_subquadratic_ops_supported(device_index: int | None = None) -> None: """Validate all subquadratic_ops_torch CUDA kernels used by Evo2.""" + warn_if_host_driver_too_old() ensure_subquadratic_causal_conv1d_supported(device_index) ensure_subquadratic_fft_causal_conv1d_supported(device_index) ensure_subquadratic_b2b_causal_conv1d_supported(device_index) diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_subquadratic_safety.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_subquadratic_safety.py new file mode 100644 index 0000000000..8558a65244 --- /dev/null +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_subquadratic_safety.py @@ -0,0 +1,80 @@ +# SPDX-FileCopyrightText: Copyright (c) 2026 NVIDIA CORPORATION & AFFILIATES. All rights reserved. +# SPDX-License-Identifier: LicenseRef-Apache2 +# +# Licensed under the Apache License, Version 2.0 (the "License"); +# you may not use this file except in compliance with the License. +# You may obtain a copy of the License at +# +# http://www.apache.org/licenses/LICENSE-2.0 +# +# Unless required by applicable law or agreed to in writing, software +# distributed under the License is distributed on an "AS IS" BASIS, +# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. +# See the License for the specific language governing permissions and +# limitations under the License. + +import warnings + +import pytest + +from bionemo.evo2.models.megatron.hyena import subquadratic_safety as sqs + + +def test_cuda_version_to_str(): + """NVML integer versions format as 'major.minor', and None as 'unknown'.""" + assert sqs._cuda_version_to_str(13020) == "13.2" + assert sqs._cuda_version_to_str(12080) == "12.8" + assert sqs._cuda_version_to_str(None) == "unknown" + + +def _patch_versions(monkeypatch, driver: int | None, image: int | None, build: str | None = "590.48.01"): + monkeypatch.setattr(sqs, "_host_driver_cuda_version", lambda: driver) + monkeypatch.setattr(sqs, "_image_cuda_version", lambda: image) + monkeypatch.setattr(sqs, "_host_driver_version", lambda: build) + + +def test_diagnostic_flags_old_driver(monkeypatch): + """A driver older than the image CUDA yields a root-cause + actionable host-driver fix.""" + _patch_versions(monkeypatch, driver=13010, image=13020) + msg = sqs._driver_image_cuda_diagnostic() + # Names the versions, the cause, an actionable fix, and that the driver is a HOST concern. + assert "13.1" in msg and "13.2" in msg + assert "ROOT CAUSE" in msg + assert "FIX:" in msg and "595" in msg + assert "HOST" in msg + + +def test_diagnostic_ok_when_driver_new_enough(monkeypatch): + """A driver at least as new as the image CUDA reports no mismatch.""" + _patch_versions(monkeypatch, driver=13020, image=13020, build="595.71.05") + assert "unlikely to be the cause" in sqs._driver_image_cuda_diagnostic() + + +def test_diagnostic_handles_unknown_versions(monkeypatch): + """Undeterminable versions degrade gracefully instead of crashing.""" + _patch_versions(monkeypatch, driver=None, image=None, build=None) + msg = sqs._driver_image_cuda_diagnostic() + assert "Could not fully determine" in msg + assert "unknown" in msg + + +def test_warn_fires_on_old_driver(monkeypatch): + """warn_if_host_driver_too_old emits a warning when the host driver is too old.""" + _patch_versions(monkeypatch, driver=13010, image=13020) + with pytest.warns(UserWarning, match="ROOT CAUSE"): + sqs.warn_if_host_driver_too_old() + + +def test_warn_silent_when_driver_new_enough(monkeypatch): + """No warning is emitted when the host driver supports the image CUDA.""" + _patch_versions(monkeypatch, driver=13020, image=13020) + with warnings.catch_warnings(): + warnings.simplefilter("error") # any warning would raise and fail the test + sqs.warn_if_host_driver_too_old() + + +def test_self_test_error_includes_fix(monkeypatch): + """A tripped kernel self-test surfaces the driver/image diagnostic and fix.""" + _patch_versions(monkeypatch, driver=13010, image=13020) + with pytest.raises(RuntimeError, match="FIX:"): + sqs._raise_subquadratic_self_test_error("causal_conv1d", "max_diff=1.0") From c271c65b48bc5f973eda643cda68e53ba66e1e96 Mon Sep 17 00:00:00 2001 From: John St John Date: Thu, 4 Jun 2026 15:01:21 -0700 Subject: [PATCH 09/10] No subq + cudagraph Signed-off-by: John St John --- .../src/bionemo/evo2/run/infer.py | 18 ++++++++++++++++++ .../tests/bionemo/evo2/run/test_infer.py | 10 +++++++--- .../tests/bionemo/evo2/test_evo2.py | 6 ++++-- 3 files changed, 29 insertions(+), 5 deletions(-) diff --git a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py index 774ca45e38..a6a97ee282 100644 --- a/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/src/bionemo/evo2/run/infer.py @@ -499,6 +499,24 @@ def setup_inference_engine( >>> components = setup_inference_engine(Path("/path/to/checkpoint"), max_batch_size=4) >>> results = generate(components, prompts=["ATCG", "GCTA"], max_new_tokens=100) """ + # subquadratic_ops_torch ships prebuilt CUDA kernels that cannot be captured into a CUDA graph + # (launching one during capture crashes the process with SIGSEGV in cuLaunchKernel), and Evo2 is + # all-Hyena so every graph-captured decode layer would hit one. They are therefore mutually + # exclusive. Honor the explicit use_subquadratic_ops opt-in by forcing eager decode. Note the + # default (cuda_graph_impl="local", use_subquadratic_ops=False) is the fast path: CUDA-graphed + # decode is ~1.4-3.7x faster than subquadratic-ops here, which only helps at very long prefill. + if use_subquadratic_ops and cuda_graph_impl != "none": + logger.warning( + "use_subquadratic_ops=True is incompatible with CUDA-graphed decode " + "(cuda_graph_impl=%r): the prebuilt subquadratic_ops_torch kernels cannot be captured " + "into a CUDA graph and crash with SIGSEGV during capture. Forcing cuda_graph_impl='none' " + "(eager decode) so the requested subquadratic-ops can run. Prefer the default " + "cuda_graph_impl='local' + use_subquadratic_ops=False unless you need subquadratic-ops " + "for very long prefill.", + cuda_graph_impl, + ) + cuda_graph_impl = "none" + # ------------------------------------------------------------------------- # Step 1: Load configuration from checkpoint # ------------------------------------------------------------------------- diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py index da1d9d9229..a64088dda4 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/run/test_infer.py @@ -692,9 +692,13 @@ def test_subquadratic_ops_with_cuda_graph_matches_baseline( The reference is the simplest path: standard kernels with CUDA graphs OFF (``cuda_graph_impl=none``). Greedy decoding (top_k=1) + a fixed seed make generation deterministic, so each of the four combinations of {standard, subq-ops} x {eager, local CUDA graphs} must produce byte-identical output. - This covers the otherwise-untested combination of fused subquadratic-ops prefill together with - CUDA-graphed decode. The subq path uses guarded kernels: if this GPU cannot run them, - ``run_infer_subprocess`` xfails (via the CUDA self-test guard) instead of producing invalid output. + + subquadratic-ops kernels cannot be captured into a CUDA graph (they SIGSEGV during capture), so + ``setup_inference_engine`` makes them mutually exclusive: requesting both forces eager decode + (``cuda_graph_impl='none'``) with a warning. Hence the ``[True, 'local']`` case runs subq-ops + eagerly rather than crashing, and must still match the baseline. The subq path uses guarded + kernels: if this GPU cannot run them, ``run_infer_subprocess`` xfails (via the CUDA self-test + guard) instead of producing invalid output. """ baseline = run_infer_subprocess( mbridge_checkpoint_path, diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py index 71586f418b..30493fb271 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py @@ -858,8 +858,10 @@ def test_batch_generate_mbridge_subquadratic_ops(sequences: list[str], tmp_path: Mirrors :func:`test_batch_generate_mbridge` (1b-bf16, greedy) but enables ``use_subquadratic_ops`` so the b2b causal-conv1d prefill and fft/causal-conv1d FIR kernels are exercised end-to-end on the - native dynamic (CUDA-graphed) decode path. This gives accuracy coverage for the subquadratic-ops - path through the dynamic engine, not just the default conv path. It xfails on hardware where the + native dynamic decode path. Because subquadratic-ops kernels cannot be captured into a CUDA graph, + ``setup_inference_engine`` forces ``cuda_graph_impl='none'`` (eager decode) when they are enabled. + This gives accuracy coverage for the subquadratic-ops path through the dynamic engine, not just the + default conv path. It xfails on hardware where the prebuilt subquadratic kernels fail their CUDA self-test (unsupported PTX/toolchain), matching the other subquadratic tests in this recipe. """ From c7dff85537a27c295abd17c8b735e8d48c96138e Mon Sep 17 00:00:00 2001 From: "John St. John" Date: Tue, 9 Jun 2026 18:52:17 +0000 Subject: [PATCH 10/10] Capture segfault in pytest subprocess Signed-off-by: John St. John --- .../models/megatron/hyena/test_hyena_utils.py | 7 +- .../tests/bionemo/evo2/test_evo2.py | 64 +++++++++++++++++-- 2 files changed, 65 insertions(+), 6 deletions(-) diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_utils.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_utils.py index eabbc62838..037319291b 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_utils.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/models/megatron/hyena/test_hyena_utils.py @@ -364,16 +364,19 @@ def test_b2b_causal_conv1d_module_matches_sequential_reference(): ) fused = b2b_module(x).float() + # subquadratic_ops_torch.b2b_causal_conv1d uses the same causal-conv + # convention as subquadratic_ops_torch.causal_conv1d: weight[-1] is the + # current-position tap. Do not flip the direct-convolution reference. projected = F.conv1d( F.pad(x.float(), (proj_kernel_size - 1, 0)), - proj_weight.float().flip(-1).unsqueeze(1), + proj_weight.float().unsqueeze(1), groups=3 * hidden_size, ) x1, x2, v = projected[:, ::3], projected[:, 1::3], projected[:, 2::3] z = x2 * v mixed = F.conv1d( F.pad(z, (mixer_kernel_size - 1, 0)), - mixer_weight.float().flip(-1).unsqueeze(1), + mixer_weight.float().unsqueeze(1), groups=hidden_size, ) reference = x1 * (mixed + bias.float()[None, :, None] * z) diff --git a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py index 30493fb271..e61d05c3e4 100644 --- a/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py +++ b/bionemo-recipes/recipes/evo2_megatron/tests/bionemo/evo2/test_evo2.py @@ -19,6 +19,8 @@ import inspect import logging import os +import subprocess +import sys from pathlib import Path from typing import Any, Literal, Set @@ -211,9 +213,8 @@ def load_weights_sharded_inplace_nemo2_to_mcore( dist_checkpointing.load(sharded_state_dict, str(distributed_checkpoint_dir)) -@pytest.fixture -def sequences(): - """Fixture that returns a list of sequences from the prompts.csv file.""" +def _load_prompt_sequences() -> list[str]: + """Return the DNA prompts used by generation accuracy tests.""" with (Path(__file__).parent / "data" / "prompts.csv").open(newline="") as f: from csv import DictReader @@ -221,6 +222,12 @@ def sequences(): return [row["Sequence"] for row in reader] +@pytest.fixture +def sequences(): + """Fixture that returns a list of sequences from the prompts.csv file.""" + return _load_prompt_sequences() + + @pytest.fixture def coding_sequences(): """Fixture that returns coding sequences from the cds_prompts.csv file.""" @@ -851,9 +858,58 @@ def test_batch_generate_mbridge( ) +_RUN_SUBQ_MBRIDGE_INPROCESS_ENV = "BIONEMO_EVO2_RUN_SUBQ_MBRIDGE_INPROCESS" + + +def _run_subq_mbridge_test_subprocess(tmp_path: Path) -> None: + """Run the native-kernel subquadratic coverage in a child pytest process.""" + env = os.environ.copy() + env[_RUN_SUBQ_MBRIDGE_INPROCESS_ENV] = "1" + node_id = f"{Path(__file__).resolve()}::test_batch_generate_mbridge_subquadratic_ops" + cmd = [ + sys.executable, + "-m", + "pytest", + "-vv", + node_id, + "--basetemp", + str(tmp_path / "subpytest"), + ] + try: + result = subprocess.run( + cmd, + check=False, + capture_output=True, + text=True, + timeout=1200, + env=env, + ) + except subprocess.TimeoutExpired as exc: + pytest.fail(f"subquadratic MBridge subprocess timed out after {exc.timeout}s") + + output = f"stdout:\n{result.stdout}\nstderr:\n{result.stderr}" + if result.returncode == 0: + if "XFAIL" in result.stdout or "xfailed" in result.stdout.lower(): + pytest.xfail("subquadratic MBridge subprocess xfailed") + return + + if "failed a CUDA self-test" in output or "subquadratic_ops kernels unsupported" in output: + pytest.xfail("subquadratic_ops_torch CUDA kernels are unsupported in this environment") + + pytest.fail(f"subquadratic MBridge subprocess failed with returncode={result.returncode}:\n{output}") + + @pytest.mark.timeout(900) @pytest.mark.slow -def test_batch_generate_mbridge_subquadratic_ops(sequences: list[str], tmp_path: Path): +def test_batch_generate_mbridge_subquadratic_ops(tmp_path: Path): + """Run subquadratic MBridge generation coverage in an isolated pytest subprocess.""" + if os.environ.get(_RUN_SUBQ_MBRIDGE_INPROCESS_ENV) != "1": + _run_subq_mbridge_test_subprocess(tmp_path) + return + _run_batch_generate_mbridge_subquadratic_ops(_load_prompt_sequences(), tmp_path) + + +def _run_batch_generate_mbridge_subquadratic_ops(sequences: list[str], tmp_path: Path): """Second-half match accuracy through the dynamic engine with the fused subquadratic-ops kernels. Mirrors :func:`test_batch_generate_mbridge` (1b-bf16, greedy) but enables ``use_subquadratic_ops``