diff --git a/src/pages/cell-line/AICS-86-147/index.md b/src/pages/cell-line/AICS-86-147/index.md index e2075693..d7e7fdf1 100644 --- a/src/pages/cell-line/AICS-86-147/index.md +++ b/src/pages/cell-line/AICS-86-147/index.md @@ -2,6 +2,7 @@ templateKey: cell-line cell_line_id: 86 status: data complete +date: 2026-07-30T22:33:00.000Z clone_number: 147 parental_line: 0 genetic_modifications: @@ -20,136 +21,194 @@ genetic_modifications: order_link: https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=AICS-0086-147&PgId=166 certificate_of_analysis: https://www.coriell.org/0/PDF/Allen/ipsc/AICS-0086-147_CofA.pdf donor_plasmid: https://www.addgene.org/133963/ -hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-42 images_and_videos: images: - image: single_plane_image_cl147.jpg - caption: "Single, mid-level plane of cells in a live hiPS cell colony expressing mEGFP-tagged fibrillarin, mTagRFP-T-tagged nucleophosmin, and HaloTag-tagged nucleolar transcription factor UBF visualized with ligand Janelia Fluor 646 (Promega). Panels show individual channels for fibrillarin, nucleolar transcription factor UBF, nucleophosmin, and an overlay of the three (counterclockwise from top right). Cells were imaged in 3D on a spinning-disk confocal microscope. Scale bar, 5μm." + caption: Single, mid-level plane of cells in a live hiPS cell colony expressing + mEGFP-tagged fibrillarin, mTagRFP-T-tagged nucleophosmin, and + HaloTag-tagged nucleolar transcription factor UBF visualized with ligand + Janelia Fluor 646 (Promega). Panels show individual channels for + fibrillarin, nucleolar transcription factor UBF, nucleophosmin, and an + overlay of the three (counterclockwise from top right). Cells were + imaged in 3D on a spinning-disk confocal microscope. Scale bar, 5μm. - image: Main_cell_line_morphology.jpg - caption: "Viability and colony formation one day (a,b) and four days post-thaw (c,d). Flattened, loosely packed cells around colony edges were observed (Fig. 4c, d; see arrows) in many mature stem cell colonies on day 4 post thaw, which is suboptimal. Small clump passaging with Versene improved the colony morphology after 4 passages (Fig. 4e, f; see arrows)." + caption: Viability and colony formation one day (a,b) and four days post-thaw + (c,d). Flattened, loosely packed cells around colony edges were observed + (Fig. 4c, d; see arrows) in many mature stem cell colonies on day 4 post + thaw, which is suboptimal. Small clump passaging with Versene improved + the colony morphology after 4 passages (Fig. 4e, f; see arrows). + - image: ReleaseWestern_AICS0086_cl147_20190822_Nucleolus_Triple_UBF_final.jpg + - image: AICS86_tripleUBTF_immuno_20200403_v5.jpg videos: - video: https://player.vimeo.com/video/442124590 - caption: "Z-stack of live hiPS cell colony expressing mEGFP-tagged fibrillarin, mTagRFP-T-tagged nucleophosmin, and HaloTag-tagged nucleolar transcription factor UBF visualized with ligand Janelia Fluor 646 (Promega). Panels show individual channels for fibrillarin, nucleolar transcription factor UBF, nucleophosmin, and an overlay of the three (counterclockwise from top right). Cells were imaged in 3D on a spinning-disk confocal microscope. Movie starts at the bottom of the cells and ends at the top. Scale bar, 5 µm." + caption: Z-stack of live hiPS cell colony expressing mEGFP-tagged fibrillarin, + mTagRFP-T-tagged nucleophosmin, and HaloTag-tagged nucleolar + transcription factor UBF visualized with ligand Janelia Fluor 646 + (Promega). Panels show individual channels for fibrillarin, nucleolar + transcription factor UBF, nucleophosmin, and an overlay of the three + (counterclockwise from top right). Cells were imaged in 3D on a + spinning-disk confocal microscope. Movie starts at the bottom of the + cells and ends at the top. Scale bar, 5 µm. - video: https://player.vimeo.com/video/442123253 - caption: "Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged fibrillarin, mTagRFP-T-tagged nucleophosmin, and HaloTag-tagged nucleolar transcription factor UBF visualized with ligand Janelia Fluor 646 (Promega). Panels show individual channels for nucleolar transcription factor UBF, fibrillarin, nucleophosmin, and an overlay of the three (left to right). Boxed regions in top row are shown enlarged in the bottom row with increased brightness. Cells were imaged in 3D on a spinning-disk confocal microscope every 3 min. A single mid-level plane is shown. Movie plays at 900x real time. Scale bar, 5 µm." + caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged + fibrillarin, mTagRFP-T-tagged nucleophosmin, and HaloTag-tagged + nucleolar transcription factor UBF visualized with ligand Janelia Fluor + 646 (Promega). Panels show individual channels for nucleolar + transcription factor UBF, fibrillarin, nucleophosmin, and an overlay of + the three (left to right). Boxed regions in top row are shown enlarged + in the bottom row with increased brightness. Cells were imaged in 3D on + a spinning-disk confocal microscope every 3 min. A single mid-level + plane is shown. Movie plays at 900x real time. Scale bar, 5 µm. - video: https://player.vimeo.com/video/442124499 - caption: "Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged fibrillarin (pseudocolored in magenta), mTagRFP-T-tagged nucleophosmin (pseudocolored in cyan), and HaloTag-tagged nucleolar transcription factor UBF visualized with ligand Janelia Fluor 646 (Promega) (pseudocolored in yellow); overlay of channels appears white where proteins are colocalized. Cells were imaged in 3D on a spinning-disk confocal microscope every 3 min. A single mid-level plane is shown. Movie plays at 1800x real time. Scale bar, 20 µm." + caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged + fibrillarin (pseudocolored in magenta), mTagRFP-T-tagged nucleophosmin + (pseudocolored in cyan), and HaloTag-tagged nucleolar transcription + factor UBF visualized with ligand Janelia Fluor 646 (Promega) + (pseudocolored in yellow); overlay of channels appears white where + proteins are colocalized. Cells were imaged in 3D on a spinning-disk + confocal microscope every 3 min. A single mid-level plane is shown. + Movie plays at 1800x real time. Scale bar, 20 µm. editing_design: ncbi_isoforms: - n - cr_rna: AACTGAAGTTCAGCGCTGTC / TCCAGGCTATTCAAGATCTC / CGAGGAGGTGGCTGGACAGC + cr_rna: AACTGAAGTTCAGCGCTGTC / TCCAGGCTATTCAAGATCTC / CGAGGAGGTGGCTGGACAGC linker: KPNSAVDGTAGPGSIAT / KPNSAVDGTAGPGSIAT / SG cas9: Wildtype spCas9 diagrams: - - title: "mEGFP Insert" + - title: mEGFP Insert images: - image: EditingDesign_gene_figure.png - caption: "Top: FBL locus with zoom in on mEGFP insertion site at FBL C-terminal exon. Middle: NPM1 locus showing 7 NPM1 isoforms with zoom in on mTagRFP-T insertion site at NPM1 C-terminal exon. Bottom: UBTF locus showing 3 UBTF isoforms with zoom in on HaloTag insertion site at UBTF N-terminal exon" -category_labels: - - Key Structure and Organelle - - Nuclear Structure + caption: "Top: FBL locus with zoom in on mEGFP insertion site at FBL C-terminal + exon. Middle: NPM1 locus showing 7 NPM1 isoforms with zoom in on + mTagRFP-T insertion site at NPM1 C-terminal exon. Bottom: UBTF locus + showing 3 UBTF isoforms with zoom in on HaloTag insertion site at + UBTF N-terminal exon" genomic_characterization: diagrams: - - title: "Schematic of Junctions" + - title: Schematic of Junctions images: - image: /img/shared/GenomicCharacterization_junction_schematic_generic.png - - title: "Karyotype Analysis" + - title: Karyotype Analysis images: - image: AICS-86_cl147_FBL_NPM1_UBTF_karyotype.JPG - caption: "After cells banks were created, one vial was thawed and 30 G-banded metaphase cells were karyotyped." + caption: After cells banks were created, one vial was thawed and 30 G-banded + metaphase cells were karyotyped. amplified_junctions: - - edited_gene: "FBL-mEGFP" - junction: "5'" + - edited_gene: FBL-mEGFP + junction: 5' expected_size: "1392" - confirmed_sequence: "yes" - - edited_gene: "FBL-mEGFP" - junction: "3'" + confirmed_sequence: yes + - edited_gene: FBL-mEGFP + junction: 3' expected_size: "1500" - confirmed_sequence: "yes" - - edited_gene: "FBL-mEGFP" - junction: "WT internal" + confirmed_sequence: yes + - edited_gene: FBL-mEGFP + junction: WT internal expected_size: "1860" - confirmed_sequence: "yes" - - edited_gene: "FBL-mEGFP" - junction: "Full junctional allele" + confirmed_sequence: yes + - edited_gene: FBL-mEGFP + junction: Full junctional allele expected_size: "Tagged: bp; Untagged: bp" - confirmed_sequence: "yes" - - edited_gene: "NPM1-mTagRFP-T" - junction: "5'" + confirmed_sequence: yes + - edited_gene: NPM1-mTagRFP-T + junction: 5' expected_size: "1500" - confirmed_sequence: "yes" - - edited_gene: "NPM1-mTagRFP-T" - junction: "3'" + confirmed_sequence: yes + - edited_gene: NPM1-mTagRFP-T + junction: 3' expected_size: "1521" - confirmed_sequence: "yes" - - edited_gene: "NPM1-mTagRFP-T" - junction: "WT internal" + confirmed_sequence: yes + - edited_gene: NPM1-mTagRFP-T + junction: WT internal expected_size: "2325" - confirmed_sequence: "yes" - - edited_gene: "NPM1-mTagRFP-T" - junction: "Full junctional allele" + confirmed_sequence: yes + - edited_gene: NPM1-mTagRFP-T + junction: Full junctional allele expected_size: "Tagged: bp; Untagged: bp" - confirmed_sequence: "yes" - - edited_gene: "UBTF-HaloTag" - junction: "5'" + confirmed_sequence: yes + - edited_gene: UBTF-HaloTag + junction: 5' expected_size: "1501" - confirmed_sequence: "yes" - - edited_gene: "UBTF-HaloTag" - junction: "3'" + confirmed_sequence: yes + - edited_gene: UBTF-HaloTag + junction: 3' expected_size: "1721" - confirmed_sequence: "yes" - - edited_gene: "UBTF-HaloTag" - junction: "WT internal" + confirmed_sequence: yes + - edited_gene: UBTF-HaloTag + junction: WT internal expected_size: "2297" - confirmed_sequence: "yes" - - edited_gene: "UBTF-HaloTag" - junction: "Full junctional allele" + confirmed_sequence: yes + - edited_gene: UBTF-HaloTag + junction: Full junctional allele expected_size: "Tagged: bp; Untagged: bp" - confirmed_sequence: "yes" - junction_table_caption: "PCR amplified 5', 3', WT, and full allele junctions. 5', 3', and WT junctions were Sanger sequenced to check for precise mEGFP, mTagRFP-T, and HaloTag insertion. Primers were designed to exclude amplification from the donor plasmid." + confirmed_sequence: yes + junction_table_caption: PCR amplified 5', 3', WT, and full allele junctions. 5', + 3', and WT junctions were Sanger sequenced to check for precise mEGFP, + mTagRFP-T, and HaloTag insertion. Primers were designed to exclude + amplification from the donor plasmid. ddpcr: - tag: FBL-mEGFP clone: 147 fp_ratio: 0.521 - plasmid: 0.0 + plasmid: 0 - tag: NPM1-mTagRFP-T clone: 147 fp_ratio: 0.492 - plasmid: 0.0 + plasmid: 0 - tag: UBTF-HaloTag clone: 147 fp_ratio: 0.482 - plasmid: 0.0 - ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: AmpR/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no detectable plasmid integration. RPP30 is known 2n reference gene." + plasmid: 0 + ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate + heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: + AmpR/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no + detectable plasmid integration. RPP30 is known 2n reference gene." +category_labels: + - Key Structure and Organelle + - Nuclear Structure +hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-42 stem_cell_characteristics: pluripotency_analysis: - - marker: "NANOG" + - marker: NANOG positive_cells: 99.7 - - marker: "SOX2" + - marker: SOX2 positive_cells: 99.8 - - marker: "OCT4" + - marker: OCT4 positive_cells: 99.3 - - marker: "SSEA-1" + - marker: SSEA-1 positive_cells: 0.08 - - marker: "SSEA-4" + - marker: SSEA-4 positive_cells: 100 - - marker: "TRA-160" + - marker: TRA-160 positive_cells: 100 - pluripotency_caption: "iPSCs were stained with directly conjugated antibodies from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, then marker-specific gates were set according to corresponding fluorescence-minus-one (FMO) controls." + pluripotency_caption: iPSCs were stained with directly conjugated antibodies + from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), + and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, + then marker-specific gates were set according to corresponding + fluorescence-minus-one (FMO) controls. trilineage_differentiation: - - germ_layer: "Ectoderm" - marker: "PAX6" + - germ_layer: Ectoderm + marker: PAX6 percent_positive_cells: Pass - - germ_layer: "Endoderm" - marker: "SOX17" + - germ_layer: Endoderm + marker: SOX17 percent_positive_cells: Pass - - germ_layer: "Mesoderm" - marker: "Brachyury" + - germ_layer: Mesoderm + marker: Brachyury percent_positive_cells: Pass - trilineage_caption: "iPSCs were subjected to a 5-7 day, non-terminal, directed differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL Technologies, Inc.). Total RNA was isolated from each lineage specific differentiation and assayed via ddPCR for the expression of lineage specific transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm)." + trilineage_caption: iPSCs were subjected to a 5-7 day, non-terminal, directed + differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL + Technologies, Inc.). Total RNA was isolated from each lineage specific + differentiation and assayed via ddPCR for the expression of lineage specific + transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm). cardiomyocyte_differentiation: - troponin_percent_positive: "76-81 (4)" - day_of_beating_percent: "100 (4)" - day_of_beating_range: "d10-d12" - cardiomyocyte_differentiation_caption: "iPSCs were differentiated to cardiomyocytes and observed for initiation of beating starting at day 6. At ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD Biosciences) and gating was based on an isotype control. Ranges observed across multiple experiments are shown for Troponin T and Day of beating initiation; number of experiments is shown in (). " ---- \ No newline at end of file + troponin_percent_positive: 76-81 (4) + day_of_beating_percent: 100 (4) + day_of_beating_range: d10-d12 + cardiomyocyte_differentiation_caption: "iPSCs were differentiated to + cardiomyocytes and observed for initiation of beating starting at day 6. At + ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD + Biosciences) and gating was based on an isotype control. Ranges observed + across multiple experiments are shown for Troponin T and Day of beating + initiation; number of experiments is shown in (). " +---