diff --git a/src/pages/cell-line/AICS-78-79/index.md b/src/pages/cell-line/AICS-78-79/index.md index e903f2d4..0a3a671c 100644 --- a/src/pages/cell-line/AICS-78-79/index.md +++ b/src/pages/cell-line/AICS-78-79/index.md @@ -2,7 +2,7 @@ templateKey: cell-line cell_line_id: 78 status: data complete -date: 2025-05-06T22:19:51.710Z +date: 2026-07-30T22:18:00.000Z clone_number: 79 parental_line: 0 genetic_modifications: @@ -17,13 +17,18 @@ genetic_modifications: order_link: https://www.coriell.org/0/Sections/Search/Sample_Detail.aspx?Ref=AICS-0078-079&PgId=166 certificate_of_analysis: https://www.coriell.org/0/PDF/Allen/ipsc/AICS-0078-079_CofA.pdf donor_plasmid: https://www.addgene.org/The_Allen_Institute_for_Cell_Science/ -hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-55 images_and_videos: images: - image: single_plane_image_cl79.jpg - caption: "Single, mid-level plane of cells in a live hiPS cell colony expressing mEGFP-tagged Tom20 and mTagRFP-T-tagged alpha-tubulin. Panels show individual channels for Tom20 (left), alpha-tubulin (middle), and the overlay of the two (right). Cells were imaged in 3D on a spinning-disk confocal microscope. Scale bar, 5μm." + caption: Single, mid-level plane of cells in a live hiPS cell colony expressing + mEGFP-tagged Tom20 and mTagRFP-T-tagged alpha-tubulin. Panels show + individual channels for Tom20 (left), alpha-tubulin (middle), and the + overlay of the two (right). Cells were imaged in 3D on a spinning-disk + confocal microscope. Scale bar, 5μm. - image: Main_cell_line_morphology.jpg - caption: "Viability and colony formation one day and three days post-thaw. Cells were treated with ROCK inhibitor for 24 hrs post-thaw." + caption: Viability and colony formation one day and three days post-thaw. Cells + were treated with ROCK inhibitor for 24 hrs post-thaw. + - image: ReleaseWestern_AICS-0078_TUBULIN_TOMM20.jpg videos: - caption: Time-lapse movie of live hiPS cell colony expressing mEGFP-tagged translocase of outer mitochondrial membrane 20 and mTagRFP-T-tagged @@ -51,67 +56,89 @@ images_and_videos: video: https://player.vimeo.com/video/1079599493 editing_design: ncbi_isoforms: - - + - null cr_rna: AATTGTAAGTGCTCAGAGCT / GATGCACTCACGCTGCGGGA linker: GGSGDPPVAT / GGSGGS cas9: Wildtype spCas9 diagrams: - - title: "mEGFP Insert" + - title: mEGFP Insert images: - image: EditingDesign_gene_figure.png - caption: "Top: TOMM20 locus with zoom in on mEGFP insertion site at TOMM20 C-terminal exon. Bottom: TUBA1B locus with zoom in on mTagRFP-T insertion site at TUBA1B N-terminus." -category_labels: - - Key Structure and Organelle + caption: "Top: TOMM20 locus with zoom in on mEGFP insertion site at TOMM20 + C-terminal exon. Bottom: TUBA1B locus with zoom in on mTagRFP-T + insertion site at TUBA1B N-terminus." genomic_characterization: diagrams: - - title: "Schematic of Junctions" + - title: Schematic of Junctions images: - image: /img/shared/GenomicCharacterization_junction_schematic_mEGFP.png amplified_junctions: - edited_gene: "" - junction: "5'" + junction: 5' expected_size: "" confirmed_sequence: "" - edited_gene: "" - junction: "3'" + junction: 3' expected_size: "" confirmed_sequence: "" - edited_gene: "" - junction: "WT" + junction: WT expected_size: "" confirmed_sequence: "" - edited_gene: "" - junction: "Full junctional allele" + junction: Full junctional allele expected_size: "Tagged: bp; Untagged: bp" confirmed_sequence: "" - junction_table_caption: "PCR amplified 5', 3', WT, and full allele junctions. 5', 3', and WT junctions were Sanger sequenced to check for precise mEGFP insertion. Primers were designed to exclude amplification from the donor plasmid." - ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: KAN/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no detectable plasmid integration. RPP30 is known 2n reference gene." + junction_table_caption: PCR amplified 5', 3', WT, and full allele junctions. 5', + 3', and WT junctions were Sanger sequenced to check for precise mEGFP + insertion. Primers were designed to exclude amplification from the donor + plasmid. + ddpcr_caption: "FP:RPP30 ratio from ddPCR assay; values = 0.5 +/- 0.1 indicate + heterozygous clone, values = 1 +/- 0.1 indicate homozygous clone. Plasmid: + KAN/RPP30 ratio from ddPCR assay; values <0.1 indicate clone with no + detectable plasmid integration. RPP30 is known 2n reference gene." +category_labels: + - Key Structure and Organelle +hpscreg_certificate_link: https://hpscreg.eu/cell-line/UCSFi001-A-55 stem_cell_characteristics: pluripotency_analysis: - - marker: "NANOG" - positive_cells: - - marker: "SOX2" - positive_cells: - - marker: "OCT4" - positive_cells: - - marker: "SSEA-1" - positive_cells: - - marker: "SSEA-4" - positive_cells: - - marker: "TRA-160" - positive_cells: - pluripotency_caption: "iPSCs were stained with directly conjugated antibodies from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, then marker-specific gates were set according to corresponding fluorescence-minus-one (FMO) controls." + - marker: NANOG + positive_cells: null + - marker: SOX2 + positive_cells: null + - marker: OCT4 + positive_cells: null + - marker: SSEA-1 + positive_cells: null + - marker: SSEA-4 + positive_cells: null + - marker: TRA-160 + positive_cells: null + pluripotency_caption: iPSCs were stained with directly conjugated antibodies + from BD Biosciences, acquired using a FACSAria III Fusion (BD Biosciences), + and analyzed using FlowJo software (Treestar, Inc.). Doublets were excluded, + then marker-specific gates were set according to corresponding + fluorescence-minus-one (FMO) controls. trilineage_differentiation: - - germ_layer: "Ectoderm" - marker: "PAX6" - percent_positive_cells: - - germ_layer: "Endoderm" - marker: "SOX17" - percent_positive_cells: - - germ_layer: "Mesoderm" - marker: "Brachyury" - percent_positive_cells: - trilineage_caption: "iPSCs were subjected to a 5-7 day, non-terminal, directed differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL Technologies, Inc.). Total RNA was isolated from each lineage specific differentiation and assayed via ddPCR for the expression of lineage specific transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm)." - cardiomyocyte_differentiation: - cardiomyocyte_differentiation_caption: "iPSCs were differentiated to cardiomyocytes and observed for initiation of beating starting at day 6. At ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD Biosciences) and gating was based on an isotype control. Ranges observed across multiple experiments are shown for Troponin T and Day of beating initiation; number of experiments is shown in (). " ---- \ No newline at end of file + - germ_layer: Ectoderm + marker: PAX6 + percent_positive_cells: null + - germ_layer: Endoderm + marker: SOX17 + percent_positive_cells: null + - germ_layer: Mesoderm + marker: Brachyury + percent_positive_cells: null + trilineage_caption: iPSCs were subjected to a 5-7 day, non-terminal, directed + differentiation using the STEMdiff™ Trilineage Differentiation Kit (STEMCELL + Technologies, Inc.). Total RNA was isolated from each lineage specific + differentiation and assayed via ddPCR for the expression of lineage specific + transcripts; Pax6(Ectoderm), Sox17(Endoderm) and Brachyury(Mesoderm). + cardiomyocyte_differentiation: null + cardiomyocyte_differentiation_caption: "iPSCs were differentiated to + cardiomyocytes and observed for initiation of beating starting at day 6. At + ~day 12, cells were fixed and stained with anti-cardiac Troponin T (BD + Biosciences) and gating was based on an isotype control. Ranges observed + across multiple experiments are shown for Troponin T and Day of beating + initiation; number of experiments is shown in (). " +---